Description :
From Genome Similarity Track
Location :
Scaffold_267:4682- 8787
Sequence
4105 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTTCCCACCACCCGTAGCGCTCTCCAGGGTTCAACTTGTACTCCAC
AATTTCGTCAGATCTTCACACGACCCAGTAGTTCGCGTTGTTCAGGATGCTGATTTTCAGGGGAAGTCATGAAATCCTGAGTCAAAGTAGTCATGCATTG
TTGGTTATCTTGGGTTCTTGTTCTCAACTCCGGCCCTACATACACTAGAACACATAACTCTGGGGCCTTCTTCAGCCCGGCGCGTACTGGGTCCCCACCC
AGCGGGCTTATTGGTTTGACGGCTTCCCAGAGTTTGCTTCGCCATCCAGGAGTTTATCCAGGATTTGGCTCGGCATGTCCTTCAGTGCACCTTGGCGGGC
GAGTTTCTTCACAGCTTCCAGTGTCTTCCAGTCTTCACACGGTTTTCCGAGATGTAGTTTGCCACAGGACTCGCACGGTTGCGCGCGACATAAGTGATTT
GGATGACCTACTTCCAGGCAGCGATCACACTTGACGTCTTTCCAGCAGTTTTCCTCTGGATGCTCCTACTTGCCGCACTTCTCGCAGAACTTGTCCCAAT
TCGGGTTCTCGCGGCGAGGGGAACGGAATCCAGAGTTCGCGTTTGATCCTGGTTGGGGTGGACGCCATCCCATGTTATCCATCACGCGATAGACCTCGTT
CGTCAGCGTCTGAGTCCACTCGGCACCCTTCATACTCGCCAGGCTCCCAGCGATAGACGTAGAAGCTTCTTCTCCAGAGATCTCACAAGTTGACCCTGAA
TTCGCGCTCGCACTTCGGGCTGAAAAACTCTGGGTTCGTCCGTGATTTCCTGGAAACGCGCGTGAATTTCAGGGTCTTCATCCGACTCAGAGTCAGAGAC
ATCATCGCTAGTCACGTACGCACGTCCTGCACGTTTCGGCTTGAAGTGCCCCTGAGGGATATTGTCGGCCCGAAAGTCACGAACTCTGGGGGGCGGAGGG
TCATGGTCGCTGCGACTCCAGACATCTTCGTCCTGTTCCAGAGCGTACTCTAGATCAGCGATACTCCTGAATCTCTGGCCTTGCAGCGACGTCTTGAGGC
GCGTGTCCCTGAGTTTCGTGATGAACCTCCGGATATGCTTCTCCAGACGCTTCGAAGACTGGCGAAAGTCAATGTCAGCCTTCCCAGCGGCGGAGTTCAG
ACGATAGAAGAAATCTAGGGCGCTCTCTGAGTTCTTCATCTCCATCGTGAAGTAGCGTTCAGAGTACGACGAGCGCGCCTTGCAGTACTTCCTCCTGAAT
GCACACACCAACTCCTTCCAGTCACGCTGAGTGCGCTTGGGCAACTGGTTGAACCAGTCACGCGCAGCTCCCGAGAGTTTTAACTTGAGCTCCTGAATTC
GCGTCTTCGTGGACCAGCCTCCCTGGGCCGCTATGTTCGCAAAACGCTGCCACCACTGTACGCGTTCTCTGAGTGACGCCTTCGTGTCGAACTCACCCAG
AGTATTCGAGTTGATGTACGGTCGGAACGTCAGGAGCGTAGTTCCAGCTTGAGCCGTAGAGGCCGCCGTCAGGTTAACCCCAGGGTTCTCGTCCGAACTG
TCGTCCGAACTTTCAGAGGACGAGTCATCATCGCTGGAATCGGAACTTGGGTCTGAGTCCGAGAGTGGGTTGACATCCTGACGCTTCTTCTTCTTCTGCT
GGTGTTTATTGGACGCAGAGCGCTTGGAGTCTGTTTAAGAGCCCTGCGAGGCCTTAGAGGTCGCTGTTCTCCTGGGATCCGACGTTTTCCCTAGAGACAC
AGGCTCAAGCTTGATATCCTGCGTCACCTTGGTCTCCGTAGCACCATGTCCCCGCTTGCCGCGCGCAACTCTGCCGGAAGTGTCGGCGGAAGTCTGCGCG
AGGGTCGCTCTTAGCTGGGAGGCGGCGACTTCGGAAGTGTTCTTCGGGTCAGCTGTCTCCCGTCTCTGGCCTGCGACACTTGCGTTTCCACTGATTACTC
CGCTGGATTTCTGGGGTAGGGTTGCAACTTCAGGGTTCAGAGGCGCTGACGACCTCACATTTGTTGCCAAATCAGGGATAGCGGTTGCGCGTCGCGCTTG
AACTTGGGCCAATGTTGCACGAAGGTCGCGCACTTGGCCAGCGCGGAAGCGCTGGATATTCTCGGAAGACTCCCGCTCTCGCTCTCTCTCCGCTTCGAGC
TCCTGGACTTTCTGCTCCATAGTCGACATTTGTTCCTTCCAACCCGCATAGGTCTCGGAAATCCAGCGCGCGCGCCCCGAGTCGGCTTCGGCTTCGCGCT
GTTGCCAGCGCTCAGTATAGGCGGCGTCCAGGCGCTCCCGCTCAAGACGTACAGCTTCCGTGATACTCTGGGTCATCCCCTGAGTTTCAATGGAACTCTG
GGTCTGGCGGGCTTCCACGTCCTGCGCACGCCGTTCGGCTTCTCCTCGGGTGTTCTCAGCGTGGACCAAGCGATCCGTGAGTTCCTGGATCTGGCGACGC
GCGTCCAGGTCATGTTGTTCCCTGAGACGCTCGCGCTCCAAGGCATCCAGGCGTTCTCTGACGAGAAACTCGCGTTGCTCCTGCTCCATACGGGCCTGCC
ACTCCTGCTGTTGTCGCAAGACATTCAGCTCGATTTGAGCGGGCCCGGACCTCGCGGACACGGACGGATCCACTCGAGCGACTCGACGCAGCTGATTTTC
TGGACATCGTCGAGCGTCGAGAGCGCACCTCGCTCTTGGAACTCTGGTGTTGACTCCGCTCATCGGCGCATCTGAAGCACGCGAGGTACCGATGGCACTT
GGCAACGTGCCTGGGGCAGCGTCCTTGGCTTCCGCCTCCAGAGAATCATGTCCATTGGACATGGAATTCAGGGGAGTGGAACCCTGGAGCGAAACGCCAG
TCGAG