Description :
From Genome Similarity Track
Location :
Scaffold_33:468172- 472344
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G010855Similar to Xpot: Exportin-T (Mus musculus)
Pytul_DAOMBR144PYU1_G010854Similar to stm: Protein starmaker (Danio rerio)

Sequence
4172 bases(100 bases per row)
AGCTCTGTACCCACGATTGGTGATCCCGGATGACGGAGAAATGCTGGCGAGAAAGAACGACCCGACGTTCCTCCCATACGACGACCAGCTCTACTTGTTT
GAGTTGACCGGACAAGTAATCGCGTCGCTCGTCTCGTCGTCATCGCCAGATATGGCGGAGATCAAGTACCAGTATGCCAAAGCAGTGCTTGAACCATTGC
TCCAGGCGCTCAATGCCTCTCTCGCAGAGCTTCAGAGTGACGTGCGAGCACAAGAATATGTTGGCGATCGATCGGCTGCGTTGCTCAACGCCATTGCGCA
TGTGCTGAAGGCTTTCAGGGGCACGAACTGCATGCTGCACCACCAGGAAACATTCACGCAAGTGCTCACAGCAGCGACATGTGTCTTGCGCGCTCTGCCT
CGCCACCCAAGCGTTCGTTCGAAGGTTGTGTTTACGTTTCACCGTTTGATTACCGTTCTTGACGGTGAGCACCTTGTTGGTAATGCGTCGGAGACTCTGA
AGCTGTTGATGGTGTACTGTGACGCGTCCGACGTGATCGAGGTCGTGCAGCTGTTGGATCAGTTGATCATCAAGTACAAGGAAGCGTTGCTGCCTTTCTT
CGAAGAAACGACGATGGTGTTTGTGCAACACTTGTGCACGCTGATGCCACCGCGAAATGCTTCTGGCGACAATGAGACAAAAGACTCGACGCAACTGGAG
CGTGAGCACATCCAGAAGTACTTGTACACGCTGTTTTTGCACCTCGCAATGCACAACTTGGACGCGGTGTTTATCAGCGAGCGCAACGTTGGTCAGTTGG
AGAGTGTGCTGCGCTTAGTATTGGAAGGATGTGCAGACGTCACTGATGCCACCATCAACCGTGGCTGCTTCACCATTATTCACGAGCTCGCGTCGAGATG
GATGCTTGGCGTGCCCGCGCCAGTGAATCCAGACCTGACGCCTTCCGCTGAGGTCAAAGCACAGTTCACCCAGTTTGTCGTCCAGGAGTTCACGTCGGCA
ATGTTCACGCTGACAAAGCGCCACCACTTTGACGTGAATGACATCCAGTGTGCAGCAACGATGAAAGAGATCGCGGTTTTCCAGGAAGTGCTCGTGAAAG
CGCTCGGCACCGAGTACATCCGGTACCTTGTCGACGTGTACTTACCTTCGATCGGTTGTCCAGCCGACCTGGCTGCATCGTACGCAGAACAAGTCGCCAC
TGGAAACCGTAAGCTGATCCAAGACGCGTTCAAAGCGTTTGTGAGTCGCATGTGATCCATTGGAAGGTAGGTAGGTAGGTATGTCCGTCTATAAGGACGA
TTACTCGATCTCTCCTCGTCCCCCCCAGGTGCCAGCCAACACGCAGAGGTAGAAACAATTTAGCTTGGCATCGAGTTTAGAGTACATGTAGTAGGTAGGG
AGTAGATCCAGGACGCAGTAGTAGGTAGCAGTAGGTTCACAACGCAGTAGGCACGTTGAAGACAACTTCAGTTAGGATTTTGAGGGAGTGGCACATGCGC
TTAATTTGCATGCTTCACCGCAGCACAGCAAACGTCGTTACCTCGTCCATTTCGGTTGGTCACCATTGCAGATGTGCTTTTGTGCTGTTCACACGTCGCA
GATTTATCTGTGAATGGCTACAAAAGGGATTTTCGCGAACTTTCTCCCAACCACGCACGATGATTGGCTAAAATCATATTGTCTCCGTTCTGATCCATTC
GTTCCAGACTCAGATTTCTTTTCAGATTTCTTTTCAGATTTCTTTTCCTACCGTCCTTTCCATTGTTTATGTTCAAATCAAATTAGAGAGAGTTGCGCGC
GAAAATGCAGACGTCGGCGGCCATGGAGCAGCAGCGCGCGCGGGATGACACCCCCATCCACAGCGAGATGCGTGACCACCACGAGCAGCAGCATGATGAC
CACGAGCAGCAGCTGGTGCGCATGCTGCAGCAGGAGACGCCAAGCGATGACAACGACCGCGAGCAGGAGGCACCAAGCGACGACAGCGTCCGACGCCACG
ACGAGCGCGACTTTCTGGATGGTGCTGAGCATGACGACGCGCAGCAGCAAGAGCAGTATGATCACTATGGTGACGGAGATTACGAAGAGGAAGACGATGA
CTTTGTGCACCGCAGGTGGTCGACGGAGCACGGTGGCGGTGCGTTTGCGTCGTCGTCTCATCGAAGCGACGGCGAACTCGAAGCGGACGAAAGCGAGCAT
GCGCGTGCTGCTTTGTATGAACGAGACTATCATCGACAAGGCAAGTTGGAGTACAGCGATGACGACGGGGAAGACGATGACGACGACAGTGCGGATGAGG
AGCTGCTAGAGCTACATTTCCGGAACGAACACGCCATGCGGTGGACGCTGCCCACCGAGTCGGATGGCCAGCATGCAGCTCCTACGCAAGGGAGCATGGA
GCGCATTGAAGCGAACGTGCGCGCTGCAATGGATCGCATCCATGACGCTAAGATCCACGATGATAGCGGATACAGCGGTGACGAGCATGAGAGTGACGTT
AATGAGAACGATGCACTCAATGAAGACGAGGACGACGACAACAATGCGGCAACGTATCATGACGACGAAGAAGCAGATGAAGATGGTGCGCACGATGATG
GGGACGAGTGGAAAATGGGCTACGGGGAAGACGGCAAGCCGTTCTACTACGACATTGTCCACGAAGCCATGGAGGCGCGCTGGTCCCACGCATCGTCGCA
GCACAGTGGAGGATACGACGACGATACGAGCCATCAGAATGGCTTTGCTGCGCACACAGACGACCTACGAGAGCACGAAGCGGAGGATCATGATAAAGAA
CATGATGGAAGTGTGTATGAGGAAGACACTGGCGGAGTGTATGACGCTGCAGATGATCACAGGGACGAGGACAGAGCAGACGAAGACCAGGAACATGAGC
ACGACGACACCGCCCAGGATGAGGAGCAGCAGCAACACGTTGACGAAGCGGATACGAAGGATACAGCAGCCATGAGTACCATCGATTGTGGCCTCAGTCT
CAGCTACTTTACAAACAGTAACCTCAGCATAGTAGAAGACGAGTGGCAGGAAGCATACACGGCCAAAGGACGAGTGTATTACTACAACCGACGCACGCGC
GAGTCGTCGTGGAAAAAGTACGCTTTGTATTGATGAGTCTCTCATGCGAGTGTGTCCTAACGAGAGTTTTTGCTGCTGATATTGTTGCCTACAGACCCGA
GAATTTTGTCTCCCGCCCTCAGCAGCAGCGCAGCGAGTTCGGGACCTCGAGTTTGTTTTCGCTGAGTCGAAGTTCGACGCTGTATACGAACGTCGACAAC
AGAGAGCACCAGAGGAAGTCGTCGTACTCGATCGAGACCCAGAATTTCGTTTTTTGTTCATTCTGTGGCTACAAACTGGTGGTTGGCGACGACGCGATGA
AAACGCACGTTAGGGAGTGTCAAGTGCAGACGTTCCACAAACAGAACCAAACAGAGCTATACAAGAAGTTTGAAGAAATGCTGTGCCTGATGTCGGAAGA
TACGACACTGCGGTCCTTGCATTACGCGTCGTCGTTTCCCGATGTCAAGCCGCTGGCGGTCTCTGCGAGTTCGCTAGAGAATTACAAAGCTCAAGCCTCC
TCCTCTGATCATGGATCGATCCAGGACAGTCTCTTCCTGCTACGGCGCCAACGCCATCACTCCGACGCGCAAAGTACCGAAGAGACAGCTCACACAGGCG
TAGAGTATAAGGAAAACGTGAGGCACGTCACGAGTGCGACTCAGCAGCCTCGACGTACACTGCAGCGGGCGTCCTCGGCAGTGTCTGCCCCGTCCAGTGA
ATCTACATCGACGACGTCGTCGAGACGCAAAACGAGCGCTGGCTCTGCGAATGACGTCGTGGGTACCAACCGTTCGCGAAAACAAGCCGTGGGGTACACC
TACCAAGAATCGGAAACGTGCCGATACTGTGGTCGTAGCTTTGCCGAAGGCAGACTAGCAAAGCACGAAGCCGTGTGTCCCCGCGTGTTTGGGAGCGAAG
GATCGTGGGGCCGCGGCGCTTTGACGGCGTCCCACGTGCCTCCAACGACACCGCGTTCGACGAGCACGTCACCGTTTGTAAAGCGATCTGGCGTTCAGTC
GAAGAAAAAGACGTTCAAGTCCACGCCGATCGAGAAGCGCAACTTGGAACTGAGCTACAAGGAGCACCAGGC