Description :
From Genome Similarity Track
Location :
Scaffold_1284:4681- 5929
Sequence
1248 bases(100 bases per row)
TGACGTGGTGGTGTAAGGCTTCAATCTCAGCGTTTGCAGCCTTGAGGAACGTCTCCGCGTTCTCACGAGCCATGATGTGGGGTGCCACCGAACGCACGGC
GGCGGCAGCCTCGGACTGAGCAAACCGCAACTGACGCTCTAAGTCGGAAACGCGTTGGGGTAATGCCGACAGCGCGTCAGGAACAGGTTGTATCGCAGCG
AGGACCTCATCGAAACCAACAGCAGTCTCGAGACGACGCTGAGTGTGTATATCGCCGTGGAGAGGAGGCACAACGCTGATCTGCACTTGGTGACGAGCCA
TTGCAGTCAAGTACGGGATTATCGAGGTCATCATGTGATCGACCGATGCCTCCGTACTTTCAGCCAGCATGGCGCGCAGCGAATCTTCGGTGAGTGGTGG
TGGACCACCAGCAGGCGCAGGAGGAGCAGCAGGAGCCATCTCCGCGGATTCAGCGACGACGGGGAGTGCTGCAGAAGCTACCGCAGGGAGTGAAGAGTCT
GGGGCAGGAAGCGCCGAATGACCAGTTGATGATGCCGCTGTCGGAGGAAGTGTAGCAGACTGAAGGGACGTTCGAACCCTCGGCCTTGCCCTCCTGAGAA
ACAAGTCGAGTACTGTGAGGTGATGAGCAAGGTGCCGATGATTCAAAGAGAAGGATGAGCTGACGTACCTCCAGCTGTTCACGTTCGCGACGTCTACGAG
GATTGAGACGCTGAAAAGCGTCGGACACTGCTCGATTCAGACGCTTGGACATACGGTGGCGAGATGGTGAATCGAAGAATGAAGAAATGTCACAACGGGC
ACCAGTACCGTGGCTTCCATTGCGACAGGGGCAGTTGTGGTGTAGTGATTTCTCCGTAGTTGCGGATTATCACCCGTCGACAAAGACGTGACACCGCCCA
AGTTGTTCAAGCGACGAACCCTCGGTCAGGTGATGTACGGAGACGCCAAGGTGCAAGGGACTCGACGGCGACACCTCCGAACGTTCAACGAGTATTGGAT
ACGGGCATATGTCACTGAATCCAGGCTGTCCTTATTATTAATAATGGACTGGCCGGATTCGCATTCAGCGGACCATCTACGGTACGAACCCTCAGTGGCT
GTTGGGATGAGTTCGCGGAAGACTCAGCGACCATTGGAAGACACGTTCACCGTCTGGGACAGGGCGCGGACCGTTAAAGATGCTCATGCGACGGTGCAGA
CGACGCTTGGCATGCAAGAAGATCCATAACGGATCATTGTTCACTTGA