Description :
From Genome Similarity Track
Location :
contig_140:4680- 7676
Transcript NameFunction/comments
g14265.t1hypothetical protein

Sequence
2996 bases(100 bases per row)
GGACCATCTGCAAGCGCTGTTCACGCTTTTTTCGCTGCAAGTAATCATACAACATGCCCCCGCACGAGAGGTTCGATATGGGTTCCCATGTTGGCTCGTC
CTGATCAGCCCATTTGATCTTAAACTCTCTGATCGATCGCGCAGTCCTCGTTGACATGGGCATTCGATCGTCAAGGATCTCCAGGACCTCGCTTTCACCA
GCCAGCCGGTCAGGCTCCCAGCTATCTTCGGGCAGGAGTTCTTCATCAAAGTCGAAACGTGAATCCTCAGTCACATCCTGCGTCAACCGAGTCCTCGGTC
GGTCCTCGAACTCGCTTACTGCCTTCAGGCGTGACACATGAACCACTGGATAGAAACGATATCCACTCCGATCGGGCAGTTCCAGCTCGTAGGCGTATTC
TTCCACCTTGTTCTTTACCCTAAACGGGCCGTGCCATCGGTGGGCAAGCTTCTTAGTCAATCCGGGCTTGACGCGCTCCATATACAGCCAGACACGGCTA
CCTGGTTCGAAGAGAGACTTCGTCTCTGCTTCAGTATGTTCGTCGTCTGTTCGTTCGCCATTTGGATGGTTGTCTGACGTCTCATCGTTCGATCGTCGAG
GTACAGCTGCCTGTTCTTTTCGACTTAAGGCTTCGTTATGTTCCTTGGCTCGACGCGTCTTTTCTGCTGCTTGGTACTCCTTGGCCATTTCAAGCGCTAT
TCCTTGCTGGCGATTCACCTCTCTTCGCCATGCTAATGCATCAGATTGCTTACCGGAACCTCGTCGTAGTGAAGACGTCATTGCATGCAGCGACGAGTGA
GCGTCCCACCCATGTACTAGGAAGAACGGGGTCTCCTTTCGCGTCGTATCTTGCGAATTGTTGATTGCGAACACTAATCGCTTTGCAATCTCGTCCCAGT
CCTGCTGTAGCGGATCTTCGACGTACACTTTCACTGACTGCATGACGGTCTTTACTGATCGCTCTTGTTGGCCGTTAGCTTGCGGCCGATAGCTTAAAGT
CGCTCTCGACCTCGATTGCATCATATCAGCAAAGGCTTGAAAGACCTCACTCATAAAACGAGGATCCCTGTCGTGCCGAATGAGTGCAGGTGCGCCGAAA
CGTCGGTATGATGGAAGGTATGGATCTTAGACACCGAAGCTTGACGGAGCGGAGGGAGGGCAGCACTCTGGGCGAGACCGGAGCGGAGACTGGAAACCAC
TTGAGGGGTAGAACGAAGATTCGAAAGTGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTACTGGATACACACTACTTGATTCT
TTACTGGATACTGAGTTACTTCAGCCAATGAGAGAGCGCCACGTCGAAGCCCATCTTGTACCTACAATCTTGTACCCACAGGTGGCGTAATCGACAGTGG
CGTAATCGTCGGTGGCGTAATCGGCGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTCACGGTCAACAACCGATACCAAACCGGTAACCCTCCATA
CCCTCAATACCCCCTCAATGCGAAGTCCCATGAATGCCGAGAGCCGCCGTCAGCTCCGTGTGGCGTGGTCCCGCAAGCGCCTTGGTCATGATGTCCGCCA
GCATCACAGAAGTCTCGCAATACTCGAGCTTCACTTCACCGCGTTTCACTTCGTCGCGGATGTGGTGGTACTTGATGTCGATGTGCTTGGCGCGGCCGTG
GTTCACCGGGTTCTTGGTCATCTTGATGCACGACTGGTTGTCTTCACGGATCATGAGGTCGGGTCCCGTGTCGTTGGCAGCCGCCAGAATCTCGCACAGC
AGGCGATGGATCCACTTGCCCTCTTGGATAGCCAGACTGAGCGCGATGTACTCCGCTTCGCTCGTAGACAGCGACACACTTGACTGCTTCTTGCTTCCCC
AGCTCACAGGCGCACTCGTGAGCATGAACGCGTAGCCTGAAGTGGACTTGCGGTCCGCGAGGTCGCCGGCCCAGTCCGCGTCCGAGTAGCCACGAAAGTC
GATCTTGTCGCCCGGCTTGAAGCAGATGCCATGCGCCTTGGTGCCTTGCAGGTAGCGAAAGATGCGCTTGACTGCAACCCAGTGTTCCTCTTGGGGGTTC
TCCATGAAGCGCGACACATAGCCAACGGCGTACGCGATGTCCGGGCGCGTGGCGGTCATCAGGTGCATCAGCGCACCAACAGCTTCGCGAAACGGAGCGT
TCACCTTGGTCGCCGCGTCGCTTGGAACCAATCGAGTGCTCATGTCCACCGGACTCACCACGGCCTTGCACTCGTCCATGGCAAAGCGCTTCAGGATGTC
GTCCACGTAGCGACGCTGGCACATGGTCACGCTGCCATCCGGGCCGTCCACCAGCTCGATCCCAAGAACAAACGCGCACTTGCCGCTGTCGGTCATCTCG
AAGTGCGTCTTCAGGTCCGTCTTCGTGCGCGAGATCAGCTCGAGCGAACTCCCGGTAATCAGCACGTCGTCCACGTACACCAGCACGAGCACGCAGTGAC
CGTCCACCACCTTGATGTAGAGGCACGGATCGAAGGCCGACACTTGGAAGCCGATAGAGCACATGAACTCGTCGAACGTCTCGTTCCACACGCGCGAAGC
TTGCTTGAGACCGTAGATGGCCTTCACCAGTTCCAGGCAGTCAAAGCCACCATCCAGCTCAACGCCTTCGGGAACCACGCAGAACACCACCTCCTTCATG
ACCCCGTACAGGAACGCTGTCACGACGTCGAGTTGGTCGAGGGGCCAGCCGAAGTACTTGGCGATCGCGATGATCATGCGCAGCGTCACGTACTTGACCA
CGGGCGAGAACGTCTCCGTGTAGTCGATGCCGTACTTCTGCTTGAAGCCCTTGGCCACGAGGCGCGCCTTGTACTTCTCGATCGAGCCGTCCGCTTTGCG
CTTGATCTTGAACACCCACTTGGTGCAGATGGCGCGCTGGCCGCTGGGCAACTTGGCAGCTCGAAACACACCACGCAGTCGCATCGACTTGAGCTC