Description :
From Genome Similarity Track
Location :
contig_28:467986- 469240
Transcript NameFunction/comments
g5655.t1hypothetical protein PHYSODRAFT_549315

Sequence
1254 bases(100 bases per row)
CCGCCCAGGAACACCGGAAGTTTGTAGCCGAGCGAGGTGTTCACAATGGCTGTACCGATGGCAAAGTTGAGTAGCTGGCCGAAGCAGTTGGCCGAGTTCA
AGGCACCAACGTACATGCCGATCTCTACATCGTCACCCATCACGTGGATGATGACTGGCACAATGCAAGAGAACCACACGGAGGAGGTCATGCCGCAGAT
AGCCACGACGAACACGTCGAAGCCCTTGTTGCTGACCCAGGCCATGACGAGCAGGAACATCTGCGGAACGGTGGACATCGTGAGCACCCACTTGAGACCG
AGCTTGCTCACCAGGAAAGGCAGACACCACGAGTAGATGTAGCCGACAATGTTGTACAGCAGGTCAGCAGTTCCGCCGGCAAGGCTGACACCGTCGTTGT
AGGCGTCTTGCTCGGCCGTGCAGGGGTCGCAGCTATCGGCGTTCGCGGAGGTTCCGCCGTACACTTCAAGGCCGAAGAACTGTCCCTTGTTGCCGTTGTA
GGCCGTGTAGCCGTACTGCACGAAGAAGAAGCCGACGCCGTAGATGACCAGCACCTTCGGCAACGTCTTGATACCGAGCCAGACAGAGTAGAAGGCGCCC
TTGACCTGTGTCCAAGCGGAGACCTGCTCCACCTTGCTGGGGTCGAGAGGGGTCTCGTGGGCGAAAACCGTCGCGACAGCAACGCACACGATCATAATGA
CAGAAAGCGTTCCCATGAACCAGTGCATGGTGAGGTAAGCCGCGCCGAACGCGTCAATGTAGACGGCCACCACAATCGAGCCCAGTGTCGACCAAGCCTG
ACCGAGAGCAGCGCCGGTAGTTTGGCGGTCACCGGCAAAGTCGGCGACTAGAAGCATGGCCGGCGTCTGGACAATGTTGACGGTGATGTCCATCCACGCG
TAGAAAATGGTGAACACGGTCGTCCACATGCGATCGCTGTCGGCGCTCGATCCATCGCCCGTGTCTCCGAGGAGGTCGCCAATTTCACGCGTGTAGCCCA
TGGCAATCCAGCAGATGACACTGAGGATACCGGCGACCACCAGGTAGGGGCGACGGCGGCCGAATCGAGACGTGGTGCGGTCACTGAAGACGCCGATACT
GGGGCCGACAATGACACCGACGATGGGACCGATGAACTGCGTGGCTTGCACGGCTGAGTTGGACAGCATGGTCGACAGGTAGGCCCCAGAGCGGCCCACT
GCGCGGACCAAGCCATGTTGATAGCCATCCGCGGCATCGACACGGCGAGCAGCA