Description :
From Genome Similarity Track
Location :
Scaffold_33:46785- 52792
Transcript NameFunction/comments
Hyaar_Emoy2804910hemicentin, putative

Sequence
6007 bases(100 bases per row)
CTGAATCGACGCTGGTGAAGTGGTGCAATAAAGAAACCCATGTGGTCAGTGCGGACAAATCAACGGCACTGCGGCTCGGGTGAAGACGGATGTGGAGCAG
AAAGCTCGACGTGGATAAGAGCGCCTAATTCCTTCTGTAGTGTAGGATCGTCGACGGCCCGAGGGGCCGGTATTCTTCTCCCTCCCTCGGCACGTCATCC
GCAGTAGGCTAGAACGAAGACAAATAACCTCGCGCGTGATTGGAACAAAGGTTTACGACATCTGTATCATCAACATTTACGCACCAAATATTCGGGCTGT
GCGCGAGGAAATTTTCGTGGGCGCCGCGTTTGGAACATGCCGTCCGTTAGCGTTTTATTTGCTGGGCGACTTCAATTTTGTCCAGAGCCCGCAACTGGAT
CGGTTAGGCCCGCGGACAGAGAGCTGTCCGGAAATTTCGGAACAGGGTTCTCTGTTGGGGAAGTGGCCCTAAGTGATGCCCGGCTGTTACAAGAAAATGC
AGCGAATTACAACGAATACACTAGTCATCACTGCACGTACTAGGCCGAGGCTTCGGCTAGTCGGCGTGATAGATTCTTCGCTCCTGATTCTTGGGCTCTG
GACGTCCTGTTGGTATCTACGCCCCCCCACAACCCTCCGATCACGAGCAAGTGGTGCTACACTTACGGGGAAAGCGTTTGGGTAGCCGATCACTTTTCCT
ATCCTATCCATTTCAATCCATCCTCACCGCGTATCAACGGACTTCATTTAGGAAATGATGGTCGCGGGTGTGGGGAAATTGCCGTCTGTCCAGTCCTGGG
ACACTTATATTGCTCAGAGCATACACTTTATAAAGGTGGTGCGGAAACGGGAAAATCAGCGGCAATAACGCTCGGTTGCAAAGCTCCGCCGACTAAACAG
GCGGCAATTCCTAACGCGACAGCAATGGATATCCACCAATGTAGAAAAAATGCATGAGGACCACCTGGATCGTCCTTAAAAGCTTTTTGCGCGGACGACG
GAGCGTCTTCTTTGTTCCCGCAATCATATTGCTGATTGGGAGCGAGATCAGCGCATCACTTCCCTGAAAGCCCGTTACGGACATGATTTTATGTGCACCA
TGTCGATCGCGGATCCATTTGCATCTGAATGGGCATCTGTCCTGAGTCAGAGTCATTGCACCACTTCTCTGCCTCTACTGGCTTTCAAGATTCGAGCTTT
TTTCGCGTCCATACCGCCAGAATAAAGTTTGATAGCTGACGATAATGAACGCTAGTTAAACCCCGTACGGAAGCAGAAATGCTCTCTGATGTCAAAGGGC
TTAATCGACATAAATCGGCCGGTCTTGATGGGCTCAGCAACGCCTTCTACAAGAAGACCGTAGGGGTCATGTTCTCAACGCTGGGTAATATCAGTAACCA
AATAATCGAGGGGTCGGAGTTGCTCCCCTCCTTCCTTGAGTCCCTAGTTCTTCCTTTTCGTAAAAAGGGCGACTCGGACGATTCCATGTATTATCGGCCA
ATCGCATTCTTGCGAAAAAGCTACAAAGTCTTTACGAAGGTGCTCGCAACACGTCTACAACACGCTTTACCCAGGACTACAAGCGACTCGCAACAACGTT
TTTTCCACGGCCGTAAAAATGGCAAAGTCGTTTATATTGATGTTGGCTCGGATCACGACTGCAGTAGTGCAGGACGACATATTGGCTGAGAAAAGTCAGT
GTATCCTACTTTTGGTCTTTCGTAAGACGTACGATACGGTAGACCGAGATTTTCTCGTCGAATCGATGCGGTGTTTGAGTTCGACGAAGGGTTTGTCAAC
CTCACTCGATGCATCCAGACCGGCCCGTCAGCCCTCTTTGTTGTAAGCGGAGACCAGTCCCAGATACTCCCGGTGAGGTCGGGTATTCGGCAGGGATTTC
CGCTTGTGCTGCTCTTAATTCTATCGGTGGTGGGGGCTTTGGGGTTAGCTTTACAGAAGGACCCAGGACTTAGAGGAATCGACGTACCAGAGTTGCAGCG
GCAAATGCACATATATTCAGCGTTTGTAGGCGACCCCACGCTATTCCTCGCGCATGCTGGGGAGATTCCGCATGCTTTACGCATTTTCAACGGTTGTAGT
GCACTGGAGGGATTACATGCCCAACTGATTAAAAGCAAGCTTAATTTTCCTTTGCAGAACAATAAATGTTAAGCACTACGAGGTGATCGAAGTTTTGCCG
CCCGAGTGCACCACCAGGTACCTGGGTTACGAGATCAGTAACGGGGACTTAAAGATCAAGAATTGGGCCCTCCGGATCCAGAAGATTCAAGGACAACTTA
GTACGGCAACTCGGGTCGCCACTAGTGTGGTGAACATGGTTCTTATTTTAAACTCCATCGCCCTTCCTTCAATTCTGCTCACATCGAGCGTCGTCGACAT
TCCCCTGTAGGCGGAAAAGAAGCTACACAACCTCAACAAGAATTTTCTATGGGCACACGCAACTTCGACAGACTCCAGGCGCAATAAGGTCAACCCAGCA
TGTTGATAACGCCACAACAGGCGGGCGGAATAGGGCTCGCTGATGCGTCGGTAGCAGTAAAAACACAGCGGACCAAGCTTGCCATGCTTTGGCTCACCCA
ACGCCCGGAAAAGTACTTCCAAGCCTGGCATGTATAGGCTTTTTGAGGGTTGAATCATAATACTGCAGGACAGTTTTCTCCTGCTGCGGTACTGCAATAA
TTAGTGTCCGGCCGACTCAGTACCTCTGGGCTAGATTTGGAAAGGGTATTAGGGGCCTTGTAAGCCCCAACAATTGAAGAGCAACACAAATCGACCGAAT
GGGTAGCGACACACTCTGCGGCGTTGCTTGACGGGGCAAATAGTTAGTGGGACGGAGACGAATGCGTTGTATCGTTTGCCTCTCCTTTCCCAACCGACCT
CTGGGCTCCGATGACATGCCGGCAGATCTCCAGATATTTTGGTCCATGTTTCAGTGGCCGCAGAACCCATTGATCCGCGATTGCAGCGGCTAAATGTTGG
TCTCAACTACATTTACTAGGATTGAGGCATGTACGCTTAAGAAAAGGTTTAATGCGTACGGGACCGGCATACTTTGTGGTGACAATACCCACTCCCGCTC
ACCAATCCAGTCATCAATCTGCCGCACACTTACGGCGGTGGGCGACCTGTGTTCTCGTCTCTTCGCCGGCCACAGCAGTCGGAACGGTTATCCACCGGAA
TTTGGCACAGAGACTCCGTCACACTCCTCAAGTTCTGTCGGCTATGCATGGTCGCTGACTTGAGATGGTATCCCATCCGGTAGACCACCGGAAGCCGCGG
TATATTACGAGCGCATCATCACTTTGTACCAAGCCGATAACGGTATGCGCTGGAGGTGTCCAGGAACATCCCGGAGTTTGCCGTTGGGCTCCCAAAGAAA
CGACAGGTGCTCCGACAAGAATATGTGAGTACGGCCTCGTCTCGAGGTGCGCCTACTATTGCACAGGTTCTCCTGAGTGGTCCCTTATACTACGCCAAAA
CGGGCCATAACAGTTGCGCTAAAATGACAAGCATTTTACCTTTATACTAATGAATTGGCCCGTCCGCTCGGAAATTACTTTAACCGTATGGAAGCACGGG
AGGGCGGGACGACTGAAAACGGGCGTCCCTACGTCAAACCCCGCAGCAAGTATGAAGACATGGGCAGGGCCTTACAACCTATCATGTATGGACGGGATAT
AGGATAGCGACGCGGCAAATAGCCTTGGATCACACTGAAATACACGAGCACAACACCTGCCACAAGGCCCCTGGCTGTAGAGAATATGTGGAGACATTGC
AGCACTTATTCTGGGACTGCTCATGCGACGTCGCCTCTTGGGACATGCTGATCGGGCACTGGACAGGAAAGAAGTAATCCATCCAGCACACCCAACAATT
CCTCCGCGCATGTTCTAGCAGAATAGTCGCCAGTATATCCGCGCACCGGAGGGAAATCCCCTCCCCACCGGTTTCACGAGGATTGTGAAGAGGCGGAACG
GATGTGGAAGCGTATGTGGCAAATTATCGCGACGATATGTCAAAACCCATCTCTGGACTGACAGGAACGATGCAGTCTATCAGGGAGCTACAAAGGATAT
AACCAGAACTGCAATACGTTTCTGGACTACAAGCATCCGCCAATTGCGCGCTATCGTGACCCGTGAGCATTGCAGGGTGCCCTTGGATATTCTAGGAGCC
ATGGTATATGCATGCATCTAGTTACTCGAGCACGAACCGAGTGGACCAACAGGCATTACCGAGGCCACCCCTGGTAATCCATTGGAATCTCCAGCGCTGA
CATCATGGCTCCAGCTTTATCTGAGATCTTGCACATAGTTATTGCTGTGTAATTAGACTATATGAACACACATAAAAAATCTATTGTGTCGTAAGGACTT
GTTTTGTGCTTGTACTTGTTCATATAACTCTAAAACTGATCCATTGTTGGGTTTTGAATAGATGGATATCCCGATTGATTTACGCTGCGGTTATGGACCT
GTTACCTCACAAGGCGACTCTGTTCAAATGCAATGGGTCCGAGACGGCAGACGAAAAGTAGACATTCTTTTACGCATGGGTAGCGGTGTAGACGACGATT
TAGATGTTTACACAGGGGAGAACAATATGGGTGTTGTTCTGAAAGAATATGCGATGAAGAATCAGATACCGGAAAGCGACGCAGATGGTGCTGGAGACTA
CATCAAAAACGACGACAATGACAACGACGATGAGACGGTCACAGGTATTGCTGGGCAATCCTCAGTTGTATTTACTGAGTTTTCGCGAACACCTGACCGA
TTTTTTCAGCTATCGATCGTGAACGTTTCCAACACTAGAGGCAGGATAATAGTTATTGTTAGATGCCTTTCGCTGTACTTCTTCAGCTGTAAATTATATG
CTCCCTCTGTTTCGCCTACGTGATAGTTAGTTACGAGCACGTAGCAGAGATATTAACGTGGTAGAATGGCTACATTGACGGATTAGCAACAACTACGACA
TGAAGACACATTAATGGCGACATGTTTGCATTACGATTGTTCATCATATCTCGCCATCGCACACTAGTCTGAAAACAGCATACAGCCATTCTCAAGTTGG
TTTGTTTCGCGTTGACACTACCGACATCCAGTGTGTACCTTACTCATTCGGACTAAACCTTGCTGCATCCGAATCACCGCGGCTTCTGGCACGGACACTA
ACTTTGTACTGCGGGTGATCGTAATTTTTCATGTCGTACCACTGGACCATTTATCCGTGAGTCGTATAGTACGGATGGAATGATGCATTCATGTCTACTC
CGTACACGATGAAGTGGGTACTGCAACTTGCTTGACACCAGGCCGGATATGATAATCAAAACAACGGTATACATTGTCGTCTCTCGTTCGACGCATACCT
GACGATCGAGTCGCTGTGTAGCGGAGCTACCCTAACTCCTTTGTCAGAGGAAGACTTCTAGACTCGCAGAGTCTCTTAGTATATCAAACTAAACGGGTAT
TAACTTTAAGGGTCTCAAGTCTTGTAGACTTGGTGAGACTTAACTCTAAGTGTATGTACAAGCTCTTAAGCTTCTAGTCCTGGTTCAGGAGACTACGACT
CCAAGGAATCAAGTGACACTAATACCAAAGAGTACTTAGCCTTAACTCAGGCACTTTACTCTTACGACCAGAGACGTCGTAGAAAGACACGTGTCTGAAA
GATCAAAAGGGGAACTGAATGTATTTACAGATTTACAGCGATGATAAACATTACTTACGTCTTTAACCTTAAAAGCTATGCTACCTAACCGAATAGTCCT
CATCGTAGTTCTTCTTGTGTACCACACCAGAACTACGTCGCCTCTATGAAGACCCTAATACTATAGATATCCTCTAACCATAAACGATAGGTACGGTATC
ATCGCTTAGCGTATCTGATAGAAAAGTACGCCTTATCAGTGACGCTGATCTCTTTCTGTGTGTACCACACCAACGTACCTGGTTATCACAACCGTTTGTG
TAACCCC