Description :
From Genome Similarity Track
Location :
scaffold_8:46782- 76496
Transcript NameFunction/comments
g513.t1hypothetical protein
g514.t1 conserved hypothetical protein
g515.t1 hypothetical protein PHYSODRAFT_293759
g516.t1hypothetical protein
g517.t1 Intraflagellar Transport Protein 140
g518.t1 conserved hypothetical protein
g519.t1hypothetical protein
g520.t1 HSF-type DNA-binding protein, putative
g521.t1 hypothetical protein PHYSODRAFT_309064
g522.t1 hypothetical protein PHYSODRAFT_468056
g523.t1 hypothetical protein PHYSODRAFT_554409
g524.t1 hypothetical protein PHYSODRAFT_321823
g525.t1 hypothetical protein PHYSODRAFT_343735

Sequence
29714 bases(100 bases per row)
GTACAGTGTCCGTAAGCTGTCGCAAGCAGCGTTGAGCACCGCCATCGTTCCCGGCCTTTCATTGATCGCAATTAACCACGAACCTGTGATTGGGATGCCT
TTCGAAAAGATTATTCAACGCGTCAGAACTGCAGCATTGCCGAAACAACTCACCTTCATGACCGAGTTCTATTACTATCAGCTGCTGACGCTGGACTTGG
AGATGCCCCGCTACTTGACGTGTATCGCAGCTCGCCGTGGAGACTTGGACTCGGCCGCTTGGTTAAGATCTTCGACCATGGAGTTGAACACACTTTGCTC
GTGGGAGAAATCTCGAGGAATGCAGGTTTTCGGCTTTGTTCCCGTGTCCGGGAAAGGTTCTCCACTTCATGCAGCTGTGCACAACGGGCAACTCGGAATG
GTCAACTATTTAATCTCGAAGGGAGCAGATGCCAATCTGTGCAACTTCAAGGGAAGGCGACCGCTGCACGTTGTGAAACAGTCGATCGATATGGCGATGA
TCATACAAAGTCTAATCGATGCAGGAGCTGATATCGATGCGGCGGAGAAGCATGGTCTTACTCCGTTGATGTTCATGTGCTCCAGATCGTCTCTCGAAGG
CTCGGCGACGTTACTGGCTCTGGGAGCTGACGTGAACCGGGTGGCGTGGTCAAATGGCTATTCAGCTCTGGAATTTGCAGTCAAGAGTGAGCGAACTGAA
CTTGTGGAGCTCTGTCTCTCAAAAGGAGCGAATCCGAACGCGCCAACATTAGATGGGAATACCAGCCTGCACTTTGCAGCCGCCTTGGCTCACACGGATA
TCATTCTCCGGCTACTGCAAAGTGGCGCCAACCCAAACGCTCAGAACCGGTATGGACAAACTCCAGCCACAGTCTTACTTGCAACCGCCTCTGGCGTAGA
TGGGGACGGTCGAATCTTGTGCCTGGAGATTTTGACATGTGCTGGCTGTCATCTAGACAAACGCGATCTATTTGGTCGTCAAGTTTCGCACTTGGCAAAT
ATCTCGGGAGATTCTCGTGTCGTCGGATTGCTGCGGAAGTTCGGGTCGCTGAACCGGGGAGGAAACGGTGTTGACGTGGACATCTTTGGGTGTACATCTG
TCGACTATACTAACCGCATCGAGGTGAACAAGGTTGCGGGATACCTGGGTGCTCAAATGCCCCATAACTCGTGGAAGATTACTGACAAGAACGACGGCGC
TTCACGATCTGTGCGCTCGAGGGCAGTTGAGGACATGATTCGTGAGCTGGTTTCCGGTGTAGAAGTTGATTTGGTGGACGTGGTGGCGTTTGTCCTGTTC
CTGGACAGCTTTTCAAGCCTGAATGAAGTGGTGGATCGGCTAGGCGAGCATCTCCGAAATGGCACCAAAAGTACGTATCAAAGGCTCTACCGGCACAGAG
TCGAATTGTAGACAAGCCACTAACTTGATTGCGTCGTGTTTATCTAGGCCACGGACTTATTCGACTCTTTATCATGATACTGCTGTTCAGGCAATCAGAA
ACAAAGGAAGCCGACGACCTGCGCGACCGCTTTTACGGCCTCATTAGCCACAACATTGACGTCCCGAAGGAAAAGCTGGTGCCGTTGATTGATGAGTACA
CCTCTCTTTACAGAGACTACTTTTCTCTTCGGGGAGCTGGAAACTATGCCATGAACTATGAGGTGGTTCCTGGAACGATGACCAAGATCTACGGTCCAGA
CTCGGGCGTTGAGTTTGTCTCCAACGAGCCTTTCCCTATGCATTTGCACCGGTGAGTAGTATGCTCATTTGTATTGACTAAGCGTTACTGAAAAATGAGT
GTTTTTATTGTCAGGTATATCGAAGCAGAGCAGTGGGCTGAGCAATGCACGCTTTTGACACACGCCGTCTTTTGCAGAATCCCAGGTGCGTTTAATCTCT
GTAGTAGAGTTATCGTTGTGAAGAAGGAAACTGATCCTTGTGGTGAACAACAGTCCAAGATTTTATTTTGACGAGCTCGAAAAATCAGCATTCAGTTGAG
TTCATCAGCATCAAGCGATGGTTCCAACACGTACGTTGCCACCGGAAAATTGATACGAAGTGTGTACTGACAATTTTGATGTTATAGATTTCTGCTTATG
TGATCAACGCGGTTTTGGTCCAAAACACCCCTGAAGAGCGCGCAGAAGTGATCTCGTTTTACCTCAAGGTACAGAAATGTTGGAAATGCTACTACGTATG
TGCGATACTAATTACGAATGACCAGGCTGCCGACTATTGTATGTCATTGCACAATCACGATACTCTAGCTGCTATTTTATATGCACTGCAATCTACTGCA
GTGCAGCGGCTTCGAAAGACCATCGATTGTGTACGTTTACGAAGCTCATGCTAGTAGAATGTCCAGGCTTTCCTGACCTTATTGGTTTTGTATTGCAGCT
GAACGTGGGTGCGAAGAAAAAGATGAACGAGATGCAACTACTTTCGGATAAGGGGTGTCGCGAAATGAACCGGTTGATGCGCAAGACTGCCAACCCAAGC
ATGCCTTATATCGGCTTGTATCTCCAGGTCTGTGCCTTTCGTCACGATGTTAGGGTGAAATCTATCTGACACCGTAGATATGTTTTAGGGCTTCGTCGGG
TTAAACGAGCTGCCTGCATATGACAAAGAGGGGATGGTGAATGCGAACCGACTGCGACGAATGGGCGAGCTGTCGATGGAAATCGTACATCGGCAGTCTG
TTGCTTACACTCTCCAGAACGACGAGGACATTGACGTAAGCTATACAACGAACTTCCGTATTCATATCCCGATACAAATATCTGACTTGTGCCTGCTTCG
ATATTGCAGAAACTGTTGCACATCTCGCTGCCGTATTCATCAGAAGAAAGTCGTTATGCTCGCTCTTTGACTCTGGAGCCACGTGAAGCGGACGCGATGC
CCCTAAGCGATCGTGGGTCGTGTGTTGTGTTTGACGATGATCTCGACCTTGAGAGTGAAGTGCGCGAGTCCATCGGTGGAGATGGGACTTTTGGGTTCCG
GCAATGGATCCGGAAGCAGCAGGTTGTGCACCGGAATCGTTCACGTTCATCGGTGATTGCGTTGTACGAGTGGGTTTAGTACTTCTATCACTTGGTTTGT
GCCCAACATTAATATATTAGCGTATTTAGTTTTCAGCGATGTATTTCTCGAAGTCCTCCATTGAAAGCATCGCATCAAAGTTAACAGGTGGCTCCTCTTG
TTCCGTTTTCTTCAGTGGACTTAAACCTTGTTCAGACGGTGGCGAGTCGCTCGTGGTCAGATCTTCCATCAGCTGCATGATACGATCCCCCTTCTCTCCA
AGCATGCAGTCATCCCTACGGTATCCACAGTATTCGCGTAAGGTTTGTCACTATGATAATACCAATTTTGCAGACATCGGATGCGTACAGTAGGCGATTC
AGCTGAATATCGTCACGTGCAACTGGGATACTGTCGTCCGACTCTGGCTGAGCGTTCTGTATCACAAACGGTGAGAGCTAAAGCAACGACTTCTTTACAG
GTTTGCGTTCGACGTACTTCTTTCTTTTTCGCAGAATCAGCGAAAAGATTGTGCAGTTCTTGACGCTTTAGTGGAGTTTTTGTCTTGCTCTCGTTGGTGG
TGGTGGACTGCTTCCAACGGTGGATCTTCGTCACGATATCTCTGTTCTCAGCGCTCGTCGTCAAGATGCAATGGAGATAAAGAAATTATAGGTACTCAAC
TAATGAAGACCTACTCGTTTTCTTCTTCCTCAGAGAAGAATCCTTTTCCCTGTTGGTGGGAAATCAACTGATTGTCAGCGAGCCTCTTCGAATCGTTCGT
CGGCGGGACGTAGCCATCAGTATGCGCTGCATCGAAAAAGGAAAAAGCTGGCGCAGTCAACGTGTTAAGACGAGGAGCAACTCCATTAATTTTCACGAGA
GGGCCTCACTGAAGTGCGTCTTGGTCTCCTCTGTCATCGTGACACTGAAAAGATGAAAGATCCGAATGGAGAGTGGTACGTGGTACCGGTGTTGAAGAGC
TCAGTCAAAGAGTGCAACCAAAAAAGTCTGCTGAATTCCGCGTACAATACATTACAGACCCCGTACATCCAGTACGCCGCGCTTGAACCTGCCCTTGGTA
GCCTGCAAGCCGAAGTCAACCTTCTTGCGCTTCTGCTGGTCTCTCGATTTGCCGCTCGCCTTCCGTTTGCCCGTCACCACATCCGACTCCTTCAGCTGAA
AATTAACCATCAACAGCAGCGATTGCAGTACAAAATGAGTTAGAATCTGCAGATAGCAACCAGCATTGAGAAATAAAACTGCTGTATCTCAGCCGTACCA
AGTCCTCGCGACGTTGCTTCCTGACTGCACCCTTGGTCTTCATTCCAATAAGCACCTTGTAAGGCACACTGCGATTCTTGGCAGCTTTACCACCAAGCGT
CTCAATTTTCTTTGCCTCGTGGGCTTTCTTCTCCTTGCCCTTTAAATTCGACGTAGCTGTCAAACCAGACAAGTTTCAGTGTCTCTAGCCGCAGCAGCTT
TTACCAAAGCCAACAGAACTACATACCAAAGTCCAGCACCGAGTCGAATGTGTCGTCGAACTCCTTGCGGATCTCCTGACGCAACGTCATCTCGGGCTCA
TCGTCCTTGGTTTTATTCTGGTCAAAATGAGAATGTGTCAGTCGTCGAACCAATTGAATACCAGGCCAACTTTCCAACAATAAAGCACGCACCTTGGTAA
CACGAGGCTTGCGCTCCTTCCAGCTCTCAGTGGGGCACTCAAACACTTGCACTTTCTTCTTCTTGCCGCTAGCCACGGGGAACTGGAACGCCATCGTGGA
CTCTAGCGAAGACTGACAAATTGAGTGAAAATTGCGCCAACCATCAATTTTGTGTAAACCACGTAAATATGTGACGCGCGCAAAAAGCAACTTCAAGCAA
AAGATGTTTGTTTTTCTCGCTACTCTCGTTTACCCATGAAAATAATACATATATCGTTATAAGCTCTGTGGTGGAGTCTCACACAAGAACTTGAACCTGG
AACAGACTGCTGTTGGTTGCTGGATGCGAGTCCCCGTTGTGATTATCTTGCTCGTCCAGCTCGTCTTCGTCACTGGCCTCGATCTCGTCGTCTCCGTATA
AGCTGCTACCGAGGTCTGAGCCGAAGCTGTCACGAATGGATCCGCTAGCGAGCGAGTCAAGTCTATCGTCGCTCTTGAGCTCCTGCTCGAAGTCGTAGAA
GCCTCGGCTCTTGATGACGCGGCTACTTCGCATGGAATTCAGACGGCGGTTGTCCTCCTGCCTGTTTGCAGAAGTTGGAGAGGAAGTCGTTCGTCGTGCA
GGTCCGTTGTTAACTTGATTCTGTGACTTGGGACTCAACGGGACGAACACGCTTTCACCAGTTAAAGACTGATTTAATACGCTCTCGTCGTCTGGAACTG
CTGGGATCGGCCTGTACCGTGATAACCGCTGGAAACGCGGAGACTCCGTAGCGTTGACAGTCAAGCGTTTCTGAGGTGTGGGCGCCGAAAAATCTGCCAT
GGACATCGGACTTGGCGGCTTTCTCCTTCGACCCTGCACTGTAGGTTGGGGCTGGTCGTCGTGGATATTTAGACCGCCAAGCGTCTGGCGAATCTGGTCC
AGTCGCGAATAAGCCTGGGCTTCAGGAGCAGTATATTGGTGATCTGGAAGCTCGAAACCATTGCGAGCATTATCCATAGGAAAGTCCGGGGGCTGAACGG
GTGATAGTCGCTGCTGAAGCGAAATAGACTGGTACTGCTGTTGTTGGGCTTGCTGCAGAGCCTGCTGCTGCGCTTGTTGTGCCTGCTGCGTCTGTAGGTC
TGCCTGCTGCTGCTCATTGAGAGCCCGTTGAGCATCCACGAGACTGGCCATTTTTTCATTCTCCAGCTGCAATAAAGCTCGCTGCACACGCAACTCCTCC
TTCTCACGCCGCACCTCATCTCTTTCTCTCCGGAGTTCCTCACGTTCACGACGGATTTCTGCCAGCAGCGAGTGGTATTCGTCAATAATACGGCTTTGCT
GCTCAAGCTGTAGGCGCGATGCCTGTGAATCGTTGTCCTGAGAATGCTGCTGTCTTGCAGCAATACCCCCACTCATTGTGTTACGATCGAATGGGTTTCG
AATGTCATCTTTCGTATCACTGTGTCCATTACGCTGTTGTAACGGAATCCGAGTCGGTGCAGGTGGAGGAAGCAGCACTTCTGCAGCTGCGCGATCTTCA
AACTGTCGTTCCCTCTGATAATACCTGTCCTCTTCCTCCCTTGCGTCATTGTGGAATGCATAGTTTTGTCGGATTGTCGGTTGGAAATCGTTCCGCTGTC
TATTCGTCGGCAATTCCGGCGGCGATGGCAGTGCATGATACGGAGAGTTCATCTCCACTCTGTTATCCAAAGCCTCGGCATTGACCGCAGGTGAGAACTG
TCCGAGACGTCGTTGTGCTCGCATCTGCTGCTCTCGAAGGTATCTCACCTCCTCTTTGGCTGCGTCCTCCTCACTGCGTCGGCGCTCCGCTTCTTGCTGC
TCCTTCAGCCGCGCCTTCTCCTGTACCTGTTCGTCCAAAATCCGCTTCCACTGCATCTGCTGCGCGCGCTCCCGAAGTCTCTGACTGGTCTCGCTCTCGT
CCGTCACTCGGAAGCGCGGATGGGACGAAGACACGCTGTTCGCCTCGCCCGTGGCAGCTCCTCGGTCCTGTCGCTGCTCGTCCTGCAGATCCACACTCTG
TGAGAACTTCCAGGGCGACTGAGAGGCCGCGGGTGGGTCCAAATAGCCGCCTTCGACCAGCCACTTGGACGGCGAACGTTCACTCGGCGCCAGCTTGCGC
TCCAGTTCCTCGCGCTCCATCTGCTCCTGGTGCTGGCGCGCACGACGCAGCGCGATCTGGTGGTCTAGTTCCCTCGCATAAGCCTCGCGTTGGCGCTGAA
TCTCGCGCGGGTCGTCGTCCTCGAGTCCGGCTTGGGTCGCCCACATCGAGTTCTTCTTCTCGATTGAATTGAAGCTTAAGCGGGTTTTTAGGAGGGAAGC
GTTTTGATTGGCTGGCGCGAAAACGAATTTGAAACGGATATTAAATGTGTTTTAAACGTTGAAACGTTGAAACTTCTCAAAAAGAAAACGAGTTGCCGAA
GAGATACGAGTCCGCGTACTTGCTTCGCACCTCTGCCAACGCCTTCTCAACTTCCAGTTTAGAGCGTTGGCACTCGGACTGCAGCAGTTGGAACTGTAGG
GATACTTTGCTCTGGAATCGGCGTAGGCGTTTGCGCTCCTTCTTCACTCCTTCGTGTCGTGACCTGTGGTGACGACTGCTGTTGCTGCTGCTCTGACAAC
GGTAGCTACTGTAGTCGCTGTCACTACCGCTGCCAATGCTGCTCTTCCGTTCGTAGCCTTCACCGTTGTCCTCATTTCCTCGTAGCATTTCCCGGATATT
GCTTCTCTCCCTCCTGCGTCGCTTGCACTGGTCCATCGTACGTAAAAGCTCCGCGTGCTGTCGTTTCAAGCTCTTTAAGCGTTCCTGGCCTCGTTCAAAC
GCCTCCTCCTCGCTGTGCAGCCACTGTTTCTTGGCCTCCACCTCAGCGTACAGCTCCGCCAGCATTTCATTGACGTCTCTGTCGTCGGTCCCGCGTGTAT
CTCCCCGCTGGGTCAAGCGCAACATCTGCTGGGATCGTCTTCCCCCTCGACTCCCGGATACTTTCTCTTGTGTGCGCATACGGAACACGACGGACTTCTC
GGTGGTGCGGACCATACCGTGTCGAGATGACCGCTCGATAGTCTGCGTGGAGAGCCATGCGGGGCTGGAGCTGGGGTCCCGCGAGTGGATGCTGGAGCTT
GAGGACGCAGCGTCTTCGCTCATTGTTTCTGAAAAGCTAAATGAGACCTTCACTCTTCAAGTTTGATATAAGGTGATATGGCTACTTTCTATCGGTTTTG
CTAAACTGCAACTTGCTGAACAAAAGTCAAAAGTGGATTTGCATGTTGTTTTTTTCCTGTTCTAAGCTTTATGTCCATCAGAGCTCGCTGTGCGGGACAG
GTTTGTTGGTAGGAAGCGGCGAGATCATTGGCGAGAAGATGGGGCGGGAGCTGTGCATTAAAGCCACAGAGTGTGCGCCGCCTGCGGATACCTGGCGAAC
AGGGATTGGACCGAGCTCGAGACGCGTGGGTACGGCCAACGCCTTCATGTCTGTCAAACCCAGTCTTCCGTGACTGCAAAGAACAAGGATACACACTATT
AAAGCCCTGTCAATAAAGATAATGCAAGCTCAAACACTTATTACGCACTCGGGTCGTCCTGAAACGTAGGCGATGCCGTCGCTCGTAACGAACAGGGTGT
GAGAGCCGCCGCACGCAGCTTGAATCACTGTTTGTCCCTTCAGCGCCTTCACCTGTCAAGCACAAAATCCAGAAATGTTAGTTAACTGTGTCTAATACCA
CTGGAAGCACGCACTACTCCGTACCAAGTGAGGCCGCGTACGACTCTTGGTATCACCAAGACCCAGTCGGCCATATTCACCTCGTCCGAAAGCGTAGCAG
TCTCCAGACTTGGCAACAACTACCGTGTGCCAACCACCGCAAGAAACACGTCTGCACAAACCCAAAGCAAAACGCATCCGTTAGCAACAAAGCTCCAGTA
CCCGGTGAAAAAACAAGGTAAGCAACGCACAGCGCTGGAATCTCATCGAAGAACTCAACGCGCTTTGGAGTCTGCTGGTCAGACGTCTGGCCTACACCAA
GCATGCCGTAGTCTTCTTTTCCCCAAATGTAAACGTGTCCGTGCTCCGTCACAGCAGCCGAGTGGAACGCACCGCACGCAACCTGCACAACCTTCTCCCC
ATTAAATCCGTCCACCAGATGCGGTCGACTAACTCCAAGAAGGCCTTCATCGTCCGTGTCCTTTAGCCACGCCGAGCCGATACCCAACTGGCCGCTGTCA
CCTCGACCCCAGACGAAGACGCGTCCGTGGTTCGTCAACGCAGCAGTATGAGTGCCACCACAGCTGATCTTCACGATTGCCTCGCCAGGTTCACCTTCAG
GCATCGGACACTTGACTGGCAGTGACTCGTGCGCAGCCTCGAACTCCTTGGGCAGACCAAGTTGGCCCCAATGGGTCTCGCCCCACATGTACAGCGTTCC
GTCATTGGCCACCGCGGCAGAATGGCAGCCTCCACACGAGATATAGTCAATCACGAGTCCTTCCTGCTCGAAGAAGGCTATTCTCTGGGGCTCATTGATG
CTCTTGAGGTCTCCATGGCCCAATTGTCCCATCTGCACCAACCAAACAAAGCACATCCAGTCAGTTTGGCTATAGGCTGCTAGCTCAACGTTCACGTACC
GATCCCCAGCCCCAAGAATACACGACGCCGTTGACTGTGAGCGCCATTGTGTGGCGAGAACCGCACGAGACGGCGACAACTTCCTCGCCCAGCAGACTGC
CGAGTTGCTGGGGGAAGTTGGAGGCCGACACGTCATCAATGGCCAAAGTCGGTCGGCGCTTGGCTCCTGTGCCCACTTGCCCGTCGTCGTTGCAGCCGAA
GGCCACCACCGCGCACTCCGTGGCGCCTGTCACGATGCTCATTCTCTGCTGATCTGCTCGCGTGAATGCAAGTTGCCGAATGACGCATTCACGGGTTTGT
ACAAATTGTACCACATGGTGCTTGGTGTGCGGCACAGCGACATTCCAATTAAGTACGAAGTGCACCTGTTGAAGTTGCATGGGTTAACTCTTTATGTTGA
CACTCGATCGTCCATGGAGGACGAACCAGTGGGCGTGTACATCTGCGCCTTGAGAATGTGGAGCTTTGGTCCGCGTAATTTACCGTGCTTGCCGTCGAGC
TGACGTTTTATCTCGGCGAACCGAAGCGCATTGGGGTTTCGAGGTAGTTGGCTCACTTTGCCTTGAGATTTGATCACGTTCGAGTCCTCGACGCTTCTTC
CGCCGGTTTTGAGTGAGTGTTGAACGTGTGAAGTTGTCTCCGGTCCCAACTCGCTTGTGTCCTCCTCGTTCACCGAATTAACTCCGTATTTCTTGGCTAC
TGAGGACGCTTTGACCTCCTGTACGATCATGCGAGTTGTACGGTTGATCTGAAATTGCTGTTTGTACTTGGCCATCAGACGCTGACGGAACGCGATGGCC
TTCGTCTGCTGTTCGCGGACCGCCATTTCCTTGCGATAGGCTTCGCGTTGCGTTGGGTACTTGATGGTAACCTGCAATGCTCGACAACGACGACGACTTC
CATCACGACGGACAAGACGCTGAATTTTCACGGCTGGAGACTGTCGAATGCCTTTCAGCCACCCTTTCTGCCGTTTAAACTCGCGGAAGACCATCCGTGT
GGTGATTCCTCTCCATCTCGCTTGAATTCGACTGACCAGTTCGTATTCACGACGGAGGACGCGTCTCGTGACCTCCAACACGTTAGTCTCCACTTTGATC
AGCGTCGGCCTCCCACCTGACCGTCGTACGTACTCCCTGTAGTTCCAATAAAACACTCCAAGCTCCGCGCCGTTTGCGTACCAGAACACCGGTGGCTCGT
TCGGACGAGCAGCTAACGCATAGCTGAGGACCTGTGGGGCCATAAAGCGGATTATCCGCAGACACCGCTCGATGAGCGTGCGTCTCCGTGCCTGCATCCC
TCTCACTCGTGTTTGGATTCTGGTAGCCGCTCGATGAATCTTTCGTAGATAGCGCTCACGCTCTACTAGCCGTCGGCGGAACTCTATTCGCCCAAGGAAT
CCACGCGCGATACGCTGAAGCAAAGCAGTAGCTGGGACTCGTCGGCGTTCGAACTCCTTTATGGCATTTCGCTCCTCCTCAATCTGTTCGTGGAAACTCA
CGACCCCTGCACGAAGATATCGCGTGCTTCCACAGCCTGGACACTTCGGTACTTGTTCATACAGGAAAGTGGTGTCTTCCCGTTCGTCAAGAGGCTGTAT
GGAGGCAGCTAATTGGTCTGCTTTGCGCCGCACTCGTTGCACATCGATGAACGTGACGCTATTACATCGCTGGCAGGTAAGGTATGGAGTCATGCAGCTG
AGAGAATCATATTGAACAGGCGATGAACCAGTCTCCAGGTTTGAATCCAGGTCGTCGGAATGCACCGTGGTTGCTTCAGCATCGGCTACGGCTGTCGGCC
CTGCGATTGCTTTGTGCATGGCCTCGAGGTTTCAGATACGAACCATCTTGGGAAGTTCGTTTCGTTTCGGATGTAAAGGTAATGGAGGCAATTATGTAAA
AACTTAGAGTGAAAATGTGTTTATAATGGCTATGGTAACTCAAATGCAAACATGCAGATACGACGTCACTTACTCGTCCTCAGCGATGTCTTCTTCCATT
TCATCTTCGATCTCATCATCTCCAGGACGCAACTTGTCCTCCCGTGAGTTAGGACGACTCATTGCTGCTTCACGAGAGCCCGGACGACTATTATGCGCTT
CACGAGACCCTGGACGGCTCGCCTCTCTCGATACTGGTCGACTGGACTTGGCTTCACGTGATCCGGGGCGGCTGGAGGAAGACGACTGCTTGTAGTCGCT
GGGCGAAGGTCTGCGACGTCGGTCGTCCCCAATAGAAACTCCAAGCTTCGCCTGAACAGCTTCCACCACTCGAGGATCCACGTACGACTTGAGTGTCAGT
CCCTTGCGTTTCATATCCTCCATCATCTCCAAGGTCTTGTTCAGCTCGCCCTCCCCGTAATAACCTTCCACCAGCATGGCATATCCGTCGCCCACACGAA
TAGCTTCCTCGATTCCTGGCTCCTCCAGTAATTTCGTGACGATTTCCATCATCTCCTTCGGGTTCTGCTTCGCCTGTTGGCGTGCGATCACAAACTGCTC
AATGAGCAAGATGCGCTTCTCGTAGCGCTTGAGCAGCGGCTCCTTGCCGTCTGAACGAGATTTGGACACAACCTGCACCGCTTCTTGCAAGGCGGAAATG
GCCTTCTCGTAGTCGCGGTACTCTTCGATCTCAACTTGAGCACAACCAGCGTAGAAGGCCGCAAGCTGCTCGAAAGCCCGCGCCTTCGTGTAGAAGCCCA
CAATATTCTTGAGGATCTCAGGATCTTTGCGCCAGTCCAGATTCTGCAGATAATTGGCCGCAAGGATGAAGATTTGAGCGTTCCGAGACACATTGGCGAA
GAACACCACCTTCTCAGTGTCTCCGGATTTCAGCAGACACTTCATAGCCTTCAGTTTGTTGCCAGCTTGGGTATATTTCTTCGTGGCCAAGTGATACGAG
CCTTGCTGCTTGCAGCACTTGGCAAGCTTGAGGAGAAGCTCTGTGCGCCTCTTCTTGTCTGCGGGTGAGGCAGTATCGTCACCTTTCGGTGGAGTCATCT
TCTCCGCCATCTCTTCGGTGACTTTTACGTCGTGTTGCATGCACACCTCAAGAGCTTCCACTGCTCGATTGCCAATCAAGCACAAGTGAACCGCTTTGGC
GTACTGGCCATTGGCGATGAAGAAGTCCGCACATTTCTTCAGAATAGCAGGCGACGTGTTACCGGAGCCGCTGAGTTCGTCCGTGAGGTGATGCAGTTCC
TCGAAGAGCTGAGCCTGGAAGCACAAGTCCAGTGCTTTAGCGGCGTTTCCTCCTTTGTGGTAGAGCTGGACAGCCTTCTCCATGTCTCGTTGCTCCTCGA
AGTACGCAGCACAGTCCAGCATGTCCGTTGGCTTGCTCATAAGGGCGAACCCCATGAGATCGGCGTCCATGCGGTGCTCCTTGGCTAGACGAATTGCGTG
GTTGTAGCACCCTCCACTAGCGAAGAAGTGGATGGCGTTGGAGATCTCGCCGTGACCTTCGAATTGGCGGGCCAAATGGTAAGCTGCCGCTCGATTTCCA
CTCGTTTGAGCCACTTTGGCGGCAGCTTGGAAGTCCTTTTTGAAGCACAAGACACGGACGATGGACAAGTAGTCCTTCGCTCTTTGGTAACTTTCCACAG
CGCTATCAAATTGACCCTGACTCTCTTGAAACTGTGCCCACCAAATGAGTAAATCGCGGTTGTTGGAGGTGGACACGTACTTCTGCAGTAGATCGACCTT
GCCCAGTTTAAAAAGCATCCTAGGGATGTCTTTCTGGTGAGTTCCAGCGTCTTCGTACGCTTCCATTGCCTCCTTGAGATCGCCCATTTCCTCATAGTGT
CGTGCCAGTGCGTGATACGTTGTTTTTAAGTGAATTCGGTCTCGTTTGGCTGCTACATCGACCGCTTTCTTCCAGTACCCACTGGCTTGATAGAGTTTGT
TGAGGAGGTCGTAGCGCCCGCATTCCCGATAAAGCCGAGCTGCATCGTCGCGAAGACCTAGTTGAATTGCCACCATAGCAATGGCCACTTCCAGTTCCGG
CTCCTTCTTGGCCTCCTGCACTGCAGCGGCTCCACGGGCGTGGCCCATGTTGCCAAGACACACTTCAGCCACGTCCAACCGTTTTGTCTTGACGCACATA
CGAGCCATATTCTCCCATACCGAAGGGTTTTCGATCAGTTTGACGGACCGATAAGCTTCGTCCATGTTGCCGACCGTCATAAAGTAGCAGAAGTCAATCA
GAGCCTGCCTCGCCTCATTGTTGACCTTGTCCAAGCCCGTGAAGTCGCGCATGATCTGCGTTCGAAGGTAACTCACTGTGTCGTAAGCCGTTGGGGTTTT
CGCAACAGGGTTGTTGACTTTCGTGCGTCCAACTTGCACTACAGTAGTGGAGTCATCTGAAGAACCAGTATCCACCTTAGCCACGAAGTACACACGCGGG
ACTTGGATACCGAGCAGCGCAGTATACTTGAGGTCTAGATCAAAGCTGTCCTGCATGAGAAGCCCGTGCTCATTGGACGCAAAGATGATCGTAATTTCCT
TATCCGAGACTTGGCCACCTCGATTGCCACCTGCACCGCCTCCTAGACCATCGTCGGCATTTAAATCTCGACGACTAGCGCCACCTGCGGTGAGTACACC
GTCGTTACCCGTTTTTACAGTCTCGCAAACGAGTAATCGAGGTTCTTGAGGGTCAAAGAATGCGGAGACAGGGTAGCGTGAAGACCCAAAGTCGAACTGC
TGATAAATGTTGAGGTCAGTTTGGAACACAAAAAGCTTGTCCATGGGCTCTCGCATTCGCAATCCACCTTCTACACGGTCGGCGAGGATACAGATACGAG
TGCCGTCTGAGTTGACGCAGATGGATCGCATGACTGCAGACTTGGTCTCCTCACCAAAAGCTTCAGGTAAATTGCCCATACTCCCCAATGCTTTTGGGTC
ACGACGAGATACGTCGAACACACGTAGAAGTCCACGATCGGTACCTACTGCAAGGAACTTGCTTTGAAGCGACAACATCGCTGGTCTTCCCTCTGCTTCC
GTGAATGAGATTGTGTTCTTCACTACACCAGCTAAATTGCACACTTCAACGTGATTCCCGTTCGCGCGGTAGATCGATTCGCCCCTGAGCACCATGGAGC
TTGAAAAGCACTTGAACTGGTTAATGAGCTTGTTGTCTCCGTCTTTCATCTCGTACACCTCTGCTTTCGAGCCATTCCAAACCACAACGGCCGAGCCGTC
GTGCGAAATTCCCTTGACACGCAGTGAAGCTTCCAACGTCGATTGAGTGATAGACACTCCAGACTGCGCTCCATCTTGGAACTTCTCAATGGAAAGCGTC
TTGGGACGAACTTGAATGACTGCTGTATCTCCACAAAGTGCTCGCTGCATGTTGCCTTCGTGCAAAATAACCAACCCTTCCACAGTGTTGGCATACAAGG
AAGGGTGTGCGTTGCTCCAGCCAATGCGAGTAACTGCACGCCCCACTTCAGCCGTGAAGAGTAAATCCCAACGATACGACACATTAACTGCGTCGGTGTT
GCCTTGTGCGGGTGTATCGACAAAAGAGGTGGCCCGCCAGAAGAACACGGCTCCCTGAGCTGTACCAGCGACGAGAATGCGTCGTCGAGGGGAGAAACTC
AAGTTGTTGACGTTGTAATTGAGTCCGCTTGACTTTGGGAGGCTCAACACGCTGTTCTCCTCCGTGCGGATGTTCCAGAATCGCACTAGTGGCTCGCCAG
ATGCGATTGCTAGTAGCCCGGGGCCAGCCCACTTGGTTTCAAGAAGAGATCCTTCTCCAGCGAGACTCAATTTAACCTTAGAGATTGGCTTCACGGTGCC
GTCAGTCGCTCCCACTTGATACACGATAAGCTGAACTGCGCGTGTGATGACAATGAGACGGTTCTGCTCTTCGTAAAACATCATCGAGTCAATTGCGTGA
TTCAGAACTTGAATGTCCGAGATGTGCCCCAGATCGTCTGCATAGTGCACTGAGCCTGCTTCGCCGCCGAAAAAGAACTGTGGGCACGCGTGCTGGGAGA
AGTTGTCACTGTGCAGTGGGGATTTAGTCACAAGAACCTCCACCCTATTAGCAATGCTGTAAGAAACTTACTTTTTGGAGTGGCTGTCTTTCAATAGGCC
TGGTCGAGCGGCAAAGACACAGTGGGTAAAGCTGCCCTGACGCGCATACTGCGTGCTGATTGAGAGTTGGCAACGGCTATCCACCTTCCACACAGCAAAA
ATCCCGTTCTCATCTGCCGACATGAGGCGGTTGCCCGCGGGTGCCCACGTCAATAGACAAACACGACTCGTGTGCGGAGAGTTCACCTCGCGAGCCGTCT
GCTCCTTGAATACCCACAGTGAGACCATACCTATAACAGCTCGTGTTAACATCTCACTCTGTCCAATCAGTTCGTACATGCAACATACCGTCGCTCCAAC
CAACGGCGAGTGCTCCTCCACGAGGTTGCCATGCCATCGTGACGATGTCAGCATTGCGCGAGTAGATATCCAGCCCTTGCTGCTTCTCTCCCTGCAGTAT
GTAGCATTGAAACGTCAGCAATTCACCTGTAAATACGTTAGCACTGGTCTTGCATCGAACCTCATCTGTGAAGAAGTGAATCTCTCGGTTCTCCAATGCG
ACGGCAAGTACAGGGTCCAGCTCTCCCCAGACCGAGCAGACCTGCCTTAAATTGGCCGCCACCGCTACATTATAGTCGTAGAACAAGGCCATGCTTCACA
GTCCTCGGAATCTTTGCGCAATGCTCTTGATTGCCATTGCTCTTGAAGCGACGCGTCGTTTCAAGATCATTTGTGTGGCACACTTCAAATATGACTATTT
ACTCTTTTTAGTCCTCCCAATTTTATTTAGTCCGTTCAAAATTGTGTACAAATTGAACTGCAATTGACTGGTTGCCACTGCTCATAGAACTCCACAGTAT
CAACAGGTGCAGTGACAGACATGGCGGTGCAAGCGAAGACGGAGAAGAGCTACAGCAAGGGCGGCTTCAACGCCAAGAAGCGCCCCGCCAGCGGCAATGA
CGACGGCAAGAAGTCCTTCATGGATCAGAAGCTGGCCAAGAAACAGCGCAAGATGCAGCGCCCGCACTACGAAATGGTCACGCGCGCCAAGCAGATCTGG
AACGTCATCCGCGAGCGCGACGTGGACAAGACCAAGCGCGCCACGCTGGTGGACGAGCTGTACACGCTGGTGAAGGGCAAGATCTACGATGTTGCGGCGA
AGCACGACGCCTCGCGCGTCATCCAGTCGCTCATGCAGCACGGCAAGCCCGAGCACCGCTCTCAGATCGTGTTGGAGATGAAGGAGCACCTCATTGAGCT
GGCCAAGATGCAGTACGGATGCTTCCTGGTGCAGAAGATGATCCGTTACGGCAGCGTGTCCGACCGTGCCGCCATTGTCAAGTGCATGACTGGCCACGTC
GTGCAGATCGGCACGCACAACATCGCCGCTAACGTTCTCGAGTACGCACAGGAATACTTGAAGCCGTCGCAGCTCACAGCGCTCAAGCTGGAGTTTTACG
GCCGGGAGTTCGCCTACTTCCAGTCGGAGAGCAAGCGTAACCTGAAGGACATCATTGCCGCGCACCCGGACAAGAAGGCGGACGTGCTCAAGCACTTGAC
CACCATCTTGAACCGCATGGTGGACAAGCAGCTCCTCGGTCTGGCCTTTGTGCAGTCTCTGCTGTGGGAGTACATGTGCAATGCCGAGCACGACGACGTT
GTGGCTATGGTGGCCAACGTACGTGACGCTTCGCTGGCTCTACTCGCTACCCGCAACGGTGCACGTGTCGTGAACAAGTGCATTTCGCTCGGTGCTGCCA
AGGACCGTAAGCGTATTATTAAGGCTCTTAAGGACAAGGTGCTGGATGCGTGCAATCACCCTAGCGGCTACCTCGTGATCATGCGCATCTTCGACGTGGT
GGATGACTCGGTTCTTGTGCAGAAATCCATTCTGGCGGAGATGAACGATGAGCTTTTCTCGATCGCCATGCACCCGAGCGGGCGTAAGGTTCTGCTGCAG
TTGCTTAGCCCTCTGAACAAGAAGTACCTCTCGGCGGATGACCTGGAGCTGCTAGAGCCGCCCATGGTGCCGTCTCCTGAGGACGCCACCGTCCTGATTG
TGAACTACAAGAAGGATCCGGACGCTCGTCGCGAGGAGCTGCTTAAGGGTCTGCTGCCCAAGCTGGAAGAGATGTGTGCTGAGAATGCTGCTGCCCTGAT
GCGCTCGAAGGAGGGTCGTGATGTGATTGTGGAGGTCGCTAAGCGGAGTGAGAGCTCGGAGCTGGCAGATAGCATTGCTACCGCTGTAGTTGCGGAGCCG
ACCGCGGAGGAAGAGCCTCTCCACAGTGATGCCAATGGCCACTACGCTTTGCGCCGCCTGATCAAGGAAACTTCGTTCGCGGAGCCTCTACTTTCTGCCG
TCGAGGAGCAGTTGCCGCAGTGGGCGACCAGCAACCGTGGCTCCTTTGTGGTCCTCGCGTTCCTGGAGGCTGAAAAAGCCCCGAAGAACGCTGCCAAGGT
GGTGAAGAAAGCGCTCAAGCCCGTCATGGGAGACCTGAAGAAGCTCGTCGACTCGCAGAAGGGCACTAAATTACTTCTTGAGAAGCTCCAATAGAGCGGA
GATAGTTCAAACTTTATAGATCCACAGGCTTTTTGTTTTTATCTTGCGTTAGTTGTGCTTTTAAGTGTCTTCTTCACTACTGCTGTCGCTATCACTATCC
TCGGACGTGTCTGTACTGTCGTCATCCCCGTCGTCGCTGCTATCGTCGTGTACTGCAATGATGGGGTTTCCTTCTCGCCAATTCTCGATCAAGTCCAATA
TTTTTGGGTGTGAGTGAAGAACAGCAAGGTAGGCCAGCGTCTCCCCGAACTGTGTTCATGCATTTGTGTTAGCTACTACAGTAGTAGACAACAATTCGTA
GTTGTTACAGCTCACCTTGTTTGTTTTTTCAACCAATTCAGCATCACACTGCTGGAGCATGTTCATCAGGAGATTGACGTTACCGCAGGCAGCCGTGTAG
TGTAATGCTGTCATACCTTGTGCCTGCAAACGAATAAATACACATTTCTTTTAGCACTTAAGTCGATGATAGCACATTTTGAACGTACGTCTTGCAAGGT
GAGGTCGGATCCAGCATTAAGAAACACCATGCCTAGCTGGTGAAGCGGTGTTCCTCCTTCAGCGCACTGCATCAACGGCGTCTGTCCAAATACCTGCTTG
AACATGCTCAGTAACATTCTGCAATACATTTCCGGGTAATATTGACGTGAAAACTTACATTTCGTGCATCGACTGAAGCACCAAGTTCGATCAACGTCTC
TGCTGCGAGCTTGCTTTCTCCAATGACCGTCAGCATCAACGGAGTCGTACCCCAGCGGTCTTGTACGTTTACATTGGCACCGTACTTGGCTAGAAGGCGC
ACAATATCAAGATTGCCAACTCGGCTAGCCCAGTGCAATGGTGTCCAGCCATCCCTCTGCAATATAGCGAGCTACGTTAATACAGAACCAGCCAGCACTC
GTAGCTTCCTACAGCAAACGTACATCTTTCTTACTGATCGATGCTCCTTTCTTTAGCAGAACGTGGCAAATGCTCGTTCGGTGCAACGTGCAAGCCCAAT
GTAGTGCATTTCTGCCGTCAGAGCCGTTTGCATCGATGTCGATCTTGTTGGCAATGCCCGAAAGTATCTCATCAACATCGTCTGCAGCAGCAAGTACTGC
TCATTAGATATTGTAACGTGACGAATGTATGTAGGCAGTCTCTTGCCTGTCTTCGCAGCTAGCGTAAAGCCATCAGCAATTCTGCCTGCTCGTTTTGCCT
CCTAGCATATCGTTACCAAACATGGAAGTTAGGTACGTCCAGCGCATTTGAAACTAAAGATGCGTACGTAGTAAGAATGCGAAAGCCGCCAGAGCAAATA
GGTTGCAGCAGCAAAAGGGATCGCAGCTATCCCATAAGTGTGTGTCGAGCTCGTTTCGATGCACGTGAACGTGTTGATGCCCATTTCTTCACGGCACTGC
TGGTCGTACGCGTCAACCATACGCTGCCATAGCGTCACAGCAGGGATAAGCGCCATCGTTTCGACCAGTGAGCACACTACGGAAGTGACCAATGTGATCT
CCTTGCCTTCTCCATTCCAAGTGGGGATTTTGATGTCAAAAGCCACCATAATGCTCACTATAAAGCTCATGATGGCTGCAATAAGCGCCACTACTGTGAA
TCCCCTTGTAGCCGCTGCATCCCCTAGACACCACGGGTCGCTGGAGGCAACAATTGAGAGCGAGCTTGCTGGAGCGTCAGTTTGCGCGGTTAGTACTGTA
ACTAGCGGCTTTCGACGTTACCAGAAGCTCCCATAGGCCGTGAAAGGCTGAGCCGCGGACGTGACGTCGGTGCTGTCGACAGCGGCGCCAGCGTTAATGA
GTTTGTAGCGCACGCCAGTACCCTGAAGAGAAGTGGAGAATCAACAAACGGGATCAAGAGATTCAAAGTCGTAGGCGCTGACTTCGCACCGTGAGGAACC
AGAGTCCGATGTCCACAGAGTTGACAGTGTCATGAGCCCATTTCTGCCCACTGCTCGCCGCCAGCAGCAGCACGAGCGATACGAAGCTGCTCACATTGCC
TGAGGGTGAATATGTTAGATGCAGCACGAGCCCAGAGGGACCAAGAGCGTCGTACCGAGAAGGAAGCGCACCCGAATCTTTATCATGGCGTCGTTTGAAG
ATCGCAAGAATCCTAATAAATGTGGCGGGATTTTCGACAAACTATCCCAAAACCAGTTTTAATACACGGTACTGGGTCGCATGTCAAGGAGAGCGCGATA
CACCATGCACAGTGCAATGAGAGCGCTGAAAATAAAATCACAAAAGCGTTGGTCTGGAAAATTGCCAGTGGCAACACGTCAAATATGACAAGCTCATGTC
CAAGAATACAGGATAAGGCATGAGCTGGTTTGCGGTGGTTTCAAGCCAAAATCTACAGGAGATTCCGAGGAAACCCGAGATTCGTGTCCAGCAACAACAC
GCAGTTTGCTGCGGCGCCGGCGAATCTGTCAATCGGCGAATCTCCACCATCCCAACGACAAATCGGGACGCAAAACGCTCGCCCCGTCAATAGCAAAAGG
AACCCGGATGTAGCCGGTCCACACTGAATGATCGGACCGATCATTCGAGATGCAAGCTGCACGGTGAAGCATACATGAATTTGGCCTTATCGCGGTGTAC
GAATACATGCAGCTGACTGTATCACCGGCAGCTTAACCCTCCTGTACGACCTCGAATGTCAAAGCTACAGGTCGTTAGCACACAGATTGCCGTTGCCATT
TGCCACATTTTGCCAGATTCAAATGCCATATTAACAAAGACGGGCCTTAAGATTGTCACGCAAGAAGTCCTAACCATAGCAAGATTCGACAAAGGTGAAG
TCCATAGTAAGCCAAGACATCAAATCGTTAATCGAATCTAGATTCAAAAAAAGAAAACTATTAGGGATTCAGTATGCCCCACGGCTTGCCGGCAGAAACG
CGCTCCTCCCTCCCAGTCTCATTTCCGATTCTGCCCTGTCGAGCGCAAGTGTTTTCTGTTGTCACTACAATGAACGTGCAAGACCTTCTCTCTAGCGAGG
TGGCGCCTGAGTGCCCGCCGTCGCCCACGATGTCGGTGAGCTCGACCTCCAGCTCGGCCTCTTCGAGCTCAAGTGAGACGGCCCCGAAGCGCGGCTGGGT
GGCCCCGTTCTTGCTGCACCTCCACCAGATGCTCCGTCGCGAGGACCCGAAAATCATTCGCTGGGCTGAGGACGGTATGGCCTTCCAGATCCTGGACAAG
GACGCTATGGCCGCGCAAATCCTGCCCAAGTACTTCAAGAACAAGAACTTCTCGAGCTTCCAACGCCAACTCAATTACTTCGGATTTCGCAAGTGGAGCA
AGGCCCGTGCGCAGTTCCCCACCTACAGCCGAGAGCACTTCACGCGCGACAACTTCAGTGAGATGTCACTTGTCAAGCGTCAGAGCAAGAAGTCGCGGAA
GCGTAAAGCGAATGCCGATGACGAGCAGCAGTCGGCCAAGCGCGTGGCCATGGCGCCGAGCACCTTCGCTGAGAAGTGCAAGCCCATTCTCCCCCGCCCC
ACTGCTGTCACCGCGGAGGTCATCGTAGCTGCTCCGGTCATGTCTTATCAGCCCCAGAGCGTGTCCCCACCGATGCACCCAGTACCGGCTTTTAGCCTGC
CTGTGCTGTCCCCCACCCGAAAGGTGAACAGCGGCTACAAGCTGCCATCCATCCGGGAGTTGTCGCTGTCCAGTGCCCTACCGTACACGGCTATCGGTCC
CATCCGACCTCGCCTCATGGCCTAAGTGTTCGTCCCGTATTTTATGGTTAGTTAACCCCAAACAATTATTTATGCGAAATAAAAATATTTTCACTCCTGA
ATTCTTTTCAAAAGTTAAAAATTCGGAACCCTTTCTAAAGGGTTATGTTGCATTCCTTTTTTCCACAAATCAATCCAACCGTTTGGCAAACGGCATCACT
TCAAGTTTCTCTTGCTGCACAGCACAAGTCGTTCACTGTTCTCGAAGGAAGATCGATTCCGCCACGTTAACAAACCTCATGCAGTTGCTATTGCTCGCAC
TGTTGCCGCTGGCAAATGCGTGCACGATGATAGCGGTGGGGCGCAACGCGACGGTCGACGGTTCCACGTTGGTGGCGCACACTGACGACGCGGGCTTTGG
TGCTGCCGACCTGCGGATGGTGCGTGTGCCAGCTCAGAATCACGAGCAAGGAGCTATGCGCCACGTATACAACGTGCAACCGGGCTACCCGCGCCTCGTT
AGCACCCAACGAGGACCCGAGTACCAGCCCAAGAACGAAGAACTGGTCATGAATCCACTCGGTGAGATTCCGCAGGTGCCGCACACCTACGGCTACTTTG
ACCAAGACTACGGCTTCATGAACGAAGTGCAGCTCAGTATTGGAGAGAGCACGAGTGGCGCCAGGACGGCGGGTTGGCCCATTGATGCTGGTCTTCATGG
ATACAACATGTTCGGCATCGGAGAACTCACTAAAGTGGCTCTGGAACGCTGCGACTCGGCCCGTTGTGCAATCCAGACGATGGGTGATCTGGCTGTCAAA
TACGGGTTTTACAGTGAAGATAGCGGCGATCCGGCCAAGCCTGACTACGTGAGCGCAGCGGAGACGCTGGGTATTGCCGACCGCTTTGGAGAAGTGTGGG
TCTTCCATGTGCTGACGGGTCCGCACAATGCTAGTGCAGTTTGGGCCGCTCAACGAGTGCTTGATACGCACGTAGTTGTGGTGGCCAACGGCTTTGTGAT
CCGAGAAATGGATCTCGATGATCCTGACCAGTTCATGGCGTCGGAGAACGTGCTGTCCTTCGCTGAAAAAATGGGGTGGTGGGAACCCAAGAAGGGCAAG
TTCGATTTCACTGCTGCATACGCTTCTCCAACTCCAGACCCCGTGCGTGCGTTATACATGGGCCGTCGTATATGGCGCGTGTTTGATCTTGTGGCGCCGT
CCTTGCATCTGGACTCCCGTCTTGGACACTACCCGGAGTTTCCGACCTACCCGTTCTCAGTTGAGCCGGACCAAAACCTCGACGTGGCGGACGTGACACA
CTTGCTGCGCGACTATTTCCAAGGTACGCCGTACGACTTGTCCAAGGGCCTAGCAGCAGGGCCGTTCGGGAATCCGATGCGGTGGGGAGGTGATGAAAAG
GGTGTGGTAGGCGGTTGGGAACGACCGATTTCCATGTATCGCACGGTTTTCAGTTTTGTGCTGCAGGCGCGTGCTCACCTTCCCGATGCGGTTGGTGGAG
TGGCTTGGTACGGCCAAAGTTCACCGCATGCATCCGTGTACGTCCCATTCTCTTGTGCGCAGCAGGAGGTGCCTTCAGCTTACGTCCTCGGAAAGGAGAG
TGAGTTTACACACGGGTCTGCCTGGTGGGCATTCAGCTTCGTGAACAACTGGAGCATGCTTCGGTTTGACGCTATCAGCAGGGATATCCGAGCTCGGGTG
GTTGAGTTGCAGAAGGCTTGCTTTGCCGAGCGCAAGGCCATGGAGCATCATGTCACTCACACGAAATCCCTTTCAGCAGCTGAAGTACGTGTGTATCTGC
AAGAACAATCGAACCTGTTGGCTTCTCGGGTAATTGACGAGTGGTGGTCTTTCGCATGGAAGCTAGTGGGTAAGTTCTCGGACGGCTACATCACCACTGG
TGAAGCTCCAGAGGAAATGGAAATGCCAGGTTATCCGGAGTGGTGGCTCAAGCTCAGCGAGTTTTCCAAGTGGCCAGGTGAGACTTTGGTGCCACCGCAC
GTTCCAGAGTTGGAAAAGCAGCTTCAGCTGTTTCAAAGTAAGCAGAATGTCGGTGCCAACCTTGGGGTGCAGGATTCTGTCGGCGGCGGGAACACGTCAG
CTTTTTCACTTGCTCAGATTGGCTTGGGGGCTGTCATTGGTGCTGTTGTCGGAGCTTCCGCTACATGGTTTGCTGCGCAGCGTCAAATGCGGTCCGGGTA
CCAGTCCATTACTTAGGAACTCAAAATGCGAAGAGTTTCCCTTTTACTTCGAAGTAGGTGTTAGTATGATCTGCTCGCTTCCTTCCTAACAACAACTTTA
AGTCCTGTCTACCGCGGCACGATAACTGAAGACTTACAAGCACTTAGTCTTCTCCAATCGCACGCCGCTTATCTATCACGAGATTGCCACCGTTTAGTAT
CTCTTGTGCGGCTCCTTGTAGTTCCGCTTGGTTGCTGGAGACACGGAACGCGAGCGTCTGTGCGGTTGTCCTTCACGCGTACTGCTCGGTGAAGCGCTTC
GGGTGCTACGGCTGTTCTTGTATGGTTGGTTGCTACGGGAACGACCCGTGTCGTTGTCGCTGAATGTTCTCCACGAGCTACTTGCCTTCTTTCCGTCGTC
CTCACGTTTCTTACGTCCGCGAATTGACGCATAGTTTCCCGTGTTTTCTTTGGTGAATCTCTCCAGTTCTCCCGGACCTCTCGACTTGGGTTTGCGTGCG
TTGACTGGCTTGGATGCAGCGATAAGGCCAGGAGTGTCCATTAGCCCCATCGCTCGCAACGTCTTCTTCTGCAGCAACGGCACCTTTTCCAGGCCAATGA
GCTGACTATATAGTGCACCCGTCTCAACGAGCTTCGTCTTGGACATTTTCAGTTTCTTGAGGTTCGAGTTGTAGAAGCCCAAAAAGGCTGCATAAGCCTT
CTCCGCAGATTGCTCCAGTTCAGTGTGAGAACGAACATTGGCGAGGGCTTGCGTGGTTCGGTAGTTCTGCTGATCCAGTTGAGGACGCTGCTCCAGTTCA
GTGAGCGGCAGGTCGGCCAGATCTCGAAGCATTGCCTTTTCAAAGTCAGCTAGCACCAGGACGCCACGGCCTTCCATACCCGCGCGAGCAGTTCGTCCCA
GCCTGTGGATGTACTGATCACGGTCCGTAAGGCCCACTTGGAGGACTAGCGACACGTCTGGGTAGTCCACACCACGCGCCGACACGTCGGACGAGAACAT
GATCACCTTCTTGCCCTTGCGGAAAGCATCAGCAGCCTTGGTACGTGCCGATTGGCTCTTACGCGAATGCATCTCCAACACATTCGGGAAACCTGCAGCC
TGGAAAAGTTGTGCCATGAACTGCGCGGACCGTGCGGTCGGCAAGAAGACAATGACCTTGTACGCCGGCAACTTCATGTGTTGCTCTAATACGCCTTCCA
CCACGGGAATGACGTCTTGCAGGTCACACACGACGTATTCTTGCACCGCCTGCGTGTTGGTCTGTTGGTCATCGCCTTCAATTGTATCCACAAACGCGTA
GTTATCCTTCAGAGCCACATCCTTGAGCTCTTCGGTCGCCGTCGGCAGTGTCGCACTGAAAAGCAGCGTCTGTCGCTCTTTCGGCAAATGGTCGATGATC
CGCATAATGTCGCGGCGGAATCCCATGTCCAGCAGGCGGTCAGCTTCGTCCAGCACCAGCACTTGCAGACTATCCATCTTCTGTCTGATGCGTCCGCTAT
TGTCTTCAAGATGCGCCTGAAGTCTTCCAGGGGTGGCCACCAGCACGTCGATTCCTGCAGGTTGCGTGAGCTCCTTCACGTCCTTGTTCACCGAACTGCC
GCCCACAAAGCAAGCAGTACGGAGTCCGTGGGCGTCCGTGAGCTTCACCGCTTCGACTGCGATCTGCTGCGCCAACTCTCGCGTCGGAGAGATCACAAGG
GCCGAAATTTTGCCCTGTTTCGGCTGCGGGTTCTTCAACATCCGCTCCAACGTGGGTAGCAGGAATGCAATGGTCTTGCCGTTGCCCGTCTTGCCCTTGG
CCAACACATCGCGTCCATTCAGCACCAATGGTAGCGTGTCCTTTTGCACATGCGTCAAAAACTCGTAGCCCATCTCGCGTGTCAAGACATCCTTGGACTT
GTGGCTAATAGGCAGCGATGCAAACGTAACGTCGCTCAGATAACCACTAGAAGAGGCCCATGGGACGCAGCTGGAGCGGAAACCACAAGCGCTATTAGGC
GAGCGCGTCAAGAGCGATGAGAGGCGGCGCGACGTCCACATGCTGAGCCGAAAATGGTAGGTCACTCGTGTGGCTATTTTTAGCCGGCTGATAATTGGCT
AAAAATAGCTTTTTTGGCCTCGTCCCTGAGTCTGATGATTTGTGAGACCTCCACCCCATTATCCGATTGACGACACACCTCAAGCATTAACGATGGCGCT
CGGACGACTGCTGCGTGTGGTGGCAGCCTCTCTCGCTCTGCTGGTCGCGGTCCCTACGCCCTCTGACGCGATGATCGTGAAGCTGGATGGCCGCGTGGAG
GAGTGTTTCCACGAATACGTGCGCACGAAGCGTACGGCCTTCATGAAGATCGGCGTGCTGGACTCCACGGGCGCCTACGACGTGCGACTGAAGGCGTTCG
GCCCGTTCTCGACGTACCCGGAGGAGGAGCTGGTGGACAAGAACTTTTTCGACCAATTGGTGATGACGCCGCACGACGAAATGAACCAAAACGTCGAGCA
CAGCGGCTTCAACTTCGAGTCGGAGCACCGCGGTGGATGGTACCGCTTCTGCCTCGACAACATGCACGACGGCAGGTCTAGGACGGTCGAATGGTACACG
TCCTTCGACCTGTCTAACGAGGATGATCTCGGTGAAGAGGACAAGCTTGATGAACAAACCCGTCAAGGTGAGTGCAACGTAAATTTGGGGGTTTTAGAAC
TCAAGCTAACGTTTTTTTTTTTACTTGTGACCGTTACAGAGCACATGGCTGGCACGAAGACGTCGCTGGATCGGTTGCAGACGCTGCTGAAGCTTATTCG
CAACGAGCAGGACTACTACCGTGCTCGAGTACATCGCCATGTTCAGAGTAAGTTTGTTCGTTGGCAAACGTATTGGTATATGATCCTGTCACTGACAATT
GGTTGTTGTTCTGTAGCTCTCGAGAGCAGCAAGTCCCGCATCATCTACTACACGGTGTTCGAGATGGCTGTGCTGGGCGCCCTGTACGGCGCGCAGTCGT
TCCTGTTGCACAAATGGTTCAGCGACCGCGGTTACATCTCCAAACGCCAATGGGCATAAGAAAAGGATGAAATGCAGCTTAGATAAAGGGCAGCGTGAAG
TAGCGCTGCTGTCTTTGTAGCTGGCTGGAGGGAGGACGTGCCTATGAGCTTAGCAAAGAATTATCGCAAGATGGCGATAGAGATTCCCAATGCCGAAATA
CTACCTTTTTGTACGAAACTTTGTTCTGTTGCGCTACTTCTGTCTCTCTGCGTAGTTGCAGCCCGTCTCCATCTCTTGGATAATTTGCTGGCACTGATGT
TGACGATCTTCAGCGCTGGTAGCACTTCCAGCACAATGCACTATCACTTTGTAGGGAGATTCGCCTTCTTCGCCTTCCTCCACCGACAAATAAAACACGG
TGTCACTCATTGACTGCGTCGGAATGAAGCGATACCTGCCTTGCTGGGGCGTCAAAATGCCTTTGATCGGACTCAGATCAAGGATCTCCCTCACTCGTGT
CAATGGGAGCTGTTCCGACATCGCCGCCACCTCCGACGCATCAGGTACAGCACCTTCCTGCCCGCTCTGCAGTGTTTGGAACGTGCCACCTTGGAAGAAA
AACACGTGGAACGGTGTGCGTTTAGTGAGTGGCTGCAGCGTGCCCGGACTGATGCACTCCAGCTCGATGAAACCCGCAACGGGCCCAACAAGGCCTTGAA
CCGAAGCTTGCAACTGCACCAGCTGTCCCGCGGCCAGCGACTCGAGCGTCGTAGAGAAGAAAATCGTCTCAGACGTGCGCAATTGTGCACTGATTTTCAT
CTGACCCAACATGATCTGCGAGCGGTTCTCTACATCAATGAGAAGCGTTCCATTCCTGTCGTAGGCGGAGGACACGAGCAGGTTCTGCAGCATGGCCGTC
TCCATCACCTCGTTCATCATGCGCATCACCTGCGCGCTCTGCGTTAAGCTCTGCCCCACACGTTCGAACACCGACTCGAACGACTGCTGCAGGCCGCCCG
CGTAGCTCTCGAGCATCTTCGCCATCTCATCCATCGTTTCAATTGGAAAGTGCCAGGTACATGTAGAATTATAGAAATTTACAGTTATAGACATGGATAC
ACATGGTCAAGTTGCAGTTCATGTTTCAATGGAGGACAACAACTTCTACAGTAGTCAACTGACTCATCCTTCGTTGCAATAAATTACGATTGGGTTCTAA
TGATGAGGAAGTCACCTGGCATTCTGCTATGAAAACTCCAGTCCGAGCTGAAGTTACTTCACTTGGTCAATTGCTGCGACCTCGATGACTTATCTGCGGC
CATAGCCGCCACGGTTGCCGCCACGGTTGCCACCACCGTTGCGACCACCATTGAAGTTTCCGCCGTTGTCGCGTGTGTACGGCGACGGCTCGATACCGGG
CACTCCGAAAAGGTTCATCTTCTTGAGCGTCCTCTTCTCGAGCTTAGGCACCTCATCCAGACCGATGAGGCGGCTGTAGTCGGCCGCAAGCTGCACAAGC
TCCACAGGCTTCAGTCTCAGACGCTTCGCATGCGAGTTGTAGAATCCAAGCCACGCCTGGTACGACTGTTGCGCCGACTTCTCCACTTCGGTGTAGCGCT
TCAGATTCTGAATGACATTCAACGTGCGCGACTGCGACGGCTCCAAAGAATTAGGGGGGTGCTTAATACTCGGCTCCAACGGCAAATCCGACAGCTTTTC
CAAGAGAGGAGTCTCGAACTCGGACAGAACGAGAACACCCTTGCCCTTCATTCCAGCACGGGCAGTACGTCCAAGACGGTGGATGTACTGGTCGCGGTCA
GTGAGGCCCACCTGCAGCACGAGCGACACATCCGGGTAGTCCACACCGCGAGCTGACACGTCCGATGAGAACATCATCACTTTCTTGCCCTTCCGGAAGG
CTTCAGCAGTCTTTGTGCGCACAGCCTGGCTCTTACGTGAGTGAATCTCTAGCACACCCGGGAAACCAGCGGCCTGGAAGAGCTGGGCCATGAACTGAGC
CGAGCGAGCGGTCGGGAAGAATAGCATCACCTTGTACGCCGGCAACTTCATGTGCTCCTCCAGAATGGACTCCACCATCGGGATCACTTCATCCATCTTG
CACACCACGTACTCCTGTTCGGTCTGCACGTTCGTATCAGCCTCATTTTCATCGATTGTGTCCACGAACGCGTAGTCCTTGCGCAGAGCGACCTTCTTCA
GCTCCTCCGTGGAAGCAGGTAGCGTGGCACTGAACAGCAGAGTCTGACGCTCCCTCGGCAAGCGCTCAATGATGCGCATCACATCCGGGCGGAAGCCCAT
GTCCAGCAGGCGGTCAGCTTCGTCCAGAATCAATACATTGGCCTTACCCAGGCGGCTCACAATGTTACCAGTGTTCTGCTTCAAGTGGTCAACCAGACGG
CCAGGGGTAGCAACCAAGATATCGATGGGCATGCTGCTGGTAAGTGCACGCTCGTCCTTCTTAATGTTGGCACCACCCACGAAGCACGTGACGTTAAGAT
CGTGGAACTTGGTGAGGCGCTTGGCCTCGGTGGCGATCTGCAGTGCCAGCTCACGTGTGGGCGAGATGGCGAGCGCAGGGATTGAACCGGAGCGACGTCC
GTCCTTGACCATGTTCTCGATCACCGGCAGCAAGAAAGCAATCGTCTTGCCATTGCCCGTCTTGGCCTTGGCCAGCACATCTTTTCCCTCCAAGATCAGT
GGGAACGTCTCGTTCTGGACATTGGTAAGGCGCTCGTACTTCAGGTCCTCCACAATGGCACGCTTGGATTTGTCCGAGATGTTAAGCGACGCAAACAGCA
CGTCCGACAGGTAGTCCAGATTCGTGGGCTTAGCGGTCTCCACAGGAGCAGGAGGAGGCGCAGAAGCGGCAGGTGCTTGAGCAGCAGGAGCTGGGGCGTT
GCCATTCTTGTTGG