Description :
From Genome Similarity Track
Location :
contig_140:46781- 63924
Transcript NameFunction/comments
g14270.t1ABG66533.1 reverse transcriptase, partial [Phytophthora sojae
g14271.t1hypothetical protein
g14272.t1hypothetical protein

Sequence
17143 bases(100 bases per row)
GAGTCATAGTCGCCGCACTCGCCCCCGACGTTTTGCTTGCGTAAACCCAATGGGAAGTGGCGCATGACCCATGCATTCAACAAGTTGACTGCAGCAACCA
TCCCGGCGTCCACGCCAATCCCTCGCAAGGACGTGTTACAGAACAACATGGCGGGCTGCACCATCTTCAGTGCGCTCGACATGGTCGATGGCTACTATCA
GCTGCTGATGCGGGAAATCAGACGTCCCGCTCACAGCGGTGAGCACACCAGCGGGAGCTGTGGGAATGGCTCGTGATGCCCCAGAGGCTGTCGAACGCAC
CAGCCACGTTCAATCGACTGGTGACTCAACTCTTCCGGCCGATGCGGCAGTTCGTACAGACGTACTTTGATGATATCTTCGTGCACAGTCGTGCCTCAGG
AGGTGAGACGGCTGTCGAAGTGCACGTTAACCACCTCCGTGAGGTATTGATGTGCATGCGCGATAATCGCTTGTATGCGAACATCAACAAGTGTATCTTC
GGAGCCGAAGAGATTCCCTTCTTGGGATGTTTCCTTGGCAAGGATAGTGTCCGTGCGGACCCTGAGAAGATATGCGCGATCGCACAATGGCCAGTGCCAG
TATCTCAGAAGGACTTGCGCAAGTGGCTTGGCCTTGGCAACTACTTACACAAGTACAGCGCCAACTACGCTGATATGGCACGGCCACTGATGAACCTTTT
GAAGAAGGAGGCGGAAGGGTCGTGGGACGATTAAGGACGGCAGGCTTTCGAGGCAATCAAAAGAAGCCTACAGAGCGCTCCGATTTTGGCTGTGCCCGAC
GATGATCGTCCCTTCAGTGTGGTATGCGACGCATCCGACTTCGCCATAGGCTGTGCCCTGCTGCAGGTCGATGCCGAAGGCAGAGAACGGGTAGTATCTT
TCCAGTCGCGCCAACTCAGGGCGGCTGAAAAGAACTACCATGTCCATGACAAGGAGCTTCTGGCGATGAAGTACGCACTCGTAAAGTTTCGGGTACACCT
GCTAGGCAGCAAACCCTTTGTGATCTACACAGATCATGCGTCCTTGCGGACAGCGACGTCGTCACCCCACCTCTCCCAGCGTATGGCGAGGTGGCTCTCC
TTCTTTGCGGAGTATAACTTCACGGTGGAGTACAAACCAGGGAAGCCGAACGTTCTCGCGGACGCGTTGTCCCGGCGTCCGGACTATGAGCTGGCGCACG
TTGCATATCTCGAGTCCCCACTCTATGAGCTGCTACGCGAGGCGTATGCAGAGGATGTCGATCTCGCCGATCTCGTAACTTCACTGAAGGTGCCTGAAAC
GGGTGTGCAACTCACTGCTCGGCAGCGCTTACGCTTGCACCGCTACTCACTAGCAGATGATCTTCTCTACTATCAGGTAGACGAAAGCGACGAGCCCCGT
ATCGTGGTTCCCAACGACGAGAACTTACGTCATCGAGTCCTCTACGAGGCACACGACACGCCGCTCAGCGGTCATCTTGGCAGAGAGAAGACGTATACGT
CTGTGGCGCGCAACTTCTGGTGGCCAGATATGTATAAGTGGGTGCGCACGTACGTGCAGACGTGTGAGACGTGCCAACGTGTGAAGCACGCCCCATCGTC
GTCGGCTCCATTGATGAGCTTGCTGGTGCCGGCTGACTGTTGGCGTTCGGTGAGCATGGATTTCATCTTTGAGCTCCCGGCGGACACGCGCGGACACACT
GGCATCTTGGTCTTCGTCTGTAGACTGAGCAAGATGGTGCGGCTTGTCGCGGTGAAGTAGAGCGTGACGGCGCCGCAAGCGGCACAGCTCTTCGTCGACA
ATGTCTTTCGACACCATGGCCTCCCGGAGGCATTCGTGAGCGATCGAGATCCGCGCTTTGTGTCACACTTTTGGACACACTTGTTCCGACTTCTCGGTAC
GAGATTGGACATGTCCACAGCGGACCATCCACAGACCGATGGTCAGACGGAGCGCGTGAACCGTGTGTTGGAAGACGTACTGCGCAGCGTCTGCACTGAA
GAACCCACCAAGTGGAGCACGCTGCTACCCCAAGTGGAGTTTGCGCTGAATAATGCTGTGCATTCGTCGACGGGTTTCACCCCATTTTACGTAAATGGCT
TGCGGCATCCGCGTACGCCGCTATCGTTGCCACCGGCTTCGAATTTGGGTGGGGGAGAGGCTATCGCCGAAGATCCGCGTGGCCTCCAAGGCCTCCGTTC
GTCCGTCAAACGGAACCTCCTCACGTTCATCGAGACAAGTGAAGCAGTACGACAGCGCGTCCGGGACGCTATGGCGGCTGCTCAAGACACGCAAAAGGAA
CACAGTGACAGGCAAGGGCGTAAGAACACGCACGTGTTTAAACTTGGGAACCAGGTCCTCCTAAACGCTAAGAATCTCCCTATCCAGGCAATCACTGCGG
TGGGCAGCACCAAGCTTCGGCCACGATTCGTGGGGCCGTTCACGGTCATTGGGGTCCACGGCAACGCGTACACGCTGGACCTGCCATCGGCCATGGCCAC
GCATCTAACGTTCTACGTGGGCTTGCTCAAGCCTTATCGCCCTGCTGAGGCAGATGACTCTGAGAGTCCGACGAGTTCGAGTACTGCCGAAGGACGCTCG
CCATCATCTGCATCAAGTTCAGCATGGGGTGGGGCTGCAGCAGCCAACGGAGCAGCGGCCCTCTGAGGACTGCGCCGACCTCGTGGACGCTTATGAGCGT
TCCCACGGAGCCGGTCGGCGTTAACCCGGCCAAGAACACTTCGAGGTTCTATCGGCTGGGACTGCCAGGACTTCTGGACCTTCTGAAGGACCTCCTCGAG
GATGACCCCCGGGGTGGGCAGGCTGCGGTCGAAGCTGCGGGTGCGCCACTGGCCGTTGACGACCATCTTCGCCATACGAAACCGAAGACGCCGCTGGGCG
AGCCAATCGAGGCGATACGGAGAGTCTGGAAACTCAGGCATGGGTTACCCCAAGTGGCGGAGCCACTGCGTGAACTCAAGTTCTTTGGATTGACGGGCCA
GGTCCGTGTCGTCGTACAAGACGACCGGACACTCGTCGTAGTGCGGCAACCTGTGCCCGGGTTCCCGACTCCGTCGGAAATACTCGCTGTAGTGTGGCGT
TGGGTTTTGGAGCCGAACTGTCAAGGTCCGACGGACGTTGCACCTTTCAGTAAAAGGCGACAGGGTGTCTTGATTGGCTGGTCTCATTTCCCGCGCTATA
GTGACCTAGGAACAATAGTGACCGAGGTCTCGGCTGGGTCTAATAACACCCCGACCAAGGTTAAAAGCCTCGTTTGTACCCATCTGGTGTCGTACCCTCG
GCTGTGTAGAGCCGGCTATACGATTTCCCACAGAGATCTGTTTACACTTGATATTTGTATAGAGATATAGGACTAGCCAAATGATGACCTACAGAGGCTC
CCAGAGCTGTAGGATAAGAGAAATAAATCAGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTC
TGGATACGTTCGGCTGCGTGGGATGCCTGTCAGCGAGCTTGGGGGTACAATGAACTGAGAGTTTGTTGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGA
GTTAGGGACGACGGAGAGTGTCGGTCCCTATATATTGGAGGAACCCGAGTGTTCCCAAGTGTATTTCACTTTACCCTCGGCAAACCCGTATTAGGCGTGA
CTGCCGGTACCCTTCCTTCTGAGGGACTGCGGGGGTTCGCGCGAAAGCGCAATATTACACATTCTAGCCCTTGCTCGTGGCTAGTTGTGCAGGTTTTAAG
GTTGACCGAACTCAACCTTGGTATACAGAGGTGCTTGCAACCAACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGATCCAACGTTCGCTGACCT
TTCGCGAGGGAAGCGTGTGTTGTTGGTGGGACTCATACCGTTCGGTAGTGAGATTTTCTGCGTGTTCCTACACGACAACTGGTGCCGCGACCCGGGATTG
GTGTGGCCTTCTGTGTGTATAGGTTCTTACCCTAACGATCATTCGAGAGAAGAAAGAAGAGAAGAAGAAAGAAGATGGCGAAAAAAGCGAAAAAAGCAGT
ACCAGCAACGCCGGTGAGGTCAAGTGGAACGCGTACCGAGGGTTCGGGACGTTCCGGTCCGTCGTTCGCGACGCCGAGTACGTTGGCGCCGATCAACGAG
CGTTCGGATAATTCTGATGAGCCGATGGACTACTCTGACGCCAAGGAAGATGATGAAGAAGATGACCTGGAAGAGTAGGCAGCGATGCCCGAGCTTTCGG
AAGCCGCTGCAGTGTCTGCAGGACGCAGCGGAGGGGTGAGGTCGCTTGCGCGAAACCTCACCGAAGAGTTGAACGAAGTGGCTGGTCCCGAACCAGCCCA
CGGTTACGACGAAGATGGGTCCGACGATCAGCGATCGTCGGCGATGGCCGAGAATTCGCATCCTCGGCCTAATGGCGGCCGGCCTCCTCTTAACGGAGAC
ACCCCGGTCGCCAACCGAGTCCGGGGCCGATACCTAGAGCTCATGAAGGTGAAGAGCAACTGGATGCGATCCTTCGCTCCAGAGGGTTGTTCGCCAAGCC
ATCTGGATGGAGCTCGGTGGCGAATTAACTGGGCCCGTGGAGTCGTGGAGTACTCGGCAGGTGGTCGAGGTGAGGCGAGGCGGGTGAACGCCTTTATCGT
CCAGGGTGTATAGCGCACGCGCGCCAGAAGACTCGGCCGATCAGGAAGCTTAAACTTTGCCTTTCGGAAAGCCCAATGGGGTCAGACTACCTCCAAAAGT
ACGGGACCCCCGGAAGTAGCTTGGCGTGTGACCTTGTGTAATCCCTATAGGTGTCGTTTGTCTTCGAAGACCGGACTCCACTGATGAGTTGTTCCTACAC
AATCAAAATGAATACAAGAATACAGAGTGCGTACGTTCACTTCCCGACGCAATTAGTACAGCTGGGGTTAGACCACTAGCAAAGCCTTCCCAGATGACCA
AATAATACAGAGAGTTATACACAATATACAGCTGCTACTTATTCTTTTGGACCCTTGAGCAGTGGGTCCGTACACCAGTCTACTTGTGTTTCACCTGGAA
GACTGGTCACTTCCAGATGCACCCTTGTTGCGCACCACTTCCAGTAAGGAGGATTTATAACTCCTTCCAGAAGATAACTTTCAGATATATCCAAAAGGAA
AACCACTTCCGGATCACTCAATATACAGTCCTATCACACAGCAGTCTATTCGATCAAATTCCGGGGGGACTACTAACAACCTCCTGAAACGGCAATTACT
ATGAAATGGGGGTCTAGAGGACACACTCCCAACTGAAATATGAAATAGGACAGATCACGTACGAATGCGCGTCACTCGGTCACCGCCTAATTTGGTCTTG
AGCCTTTCGGAGAGTTCCACGGCGGTCTTCGCGATCACGACGCGTCCAAACGCAGGCTGGGTGAACCCGGGTCCCCGGAAATACACGGCGGCTTGTCCGG
CGTTATCCCAGCGTGCTTCCAGGCCAACTGATAAGGGCCCTGGAAAACACTTGCGCCCTTGGTGGCAAAACGAACTCTCTGTTATTTTTAGTCTCTGCTA
GAAGTCTTCTGTCAAGGTCTCTGCTGGAAGTCTTCCACATGCACATTTGTCTTGGTTTCACTATAGGGTTCTTTGGCGTAATCAGCATCCGGGAGGCTGA
CACATCCTGGTCGCAAGCCGGCTCTTCGTGCATAACATATCCGGCTGGTCGTCTTGGTCGGTCGCTAATATCTTGGGCTTTGTATACTGGAAAATTGGAA
AGGTCTTGGTGGGTACAAATCAGGGGCGTCTGGTCAGCCTCCGCACCCACAACGTCTGGGTCATCTGCGAGTCACATCAGGAAGGAACTTTCGGAAGGCA
CACGTGACTTCCGGAAGTAACTCGACATTGGGAGGACTTCTGGAAGTCACTTGGTCTCAGTATGCTGTGGGAACTTGTACCAGTTCTCCGTTCGTCCTCG
TTCTTCCCTGTCGCGCGCACTTCTGGACCAATCATCACCGCGAGTGCTTCCATGGGAAATGGGAAACGACGCTCGGACATTTTACGTCCAGTCGCCACGT
GTCAACCGTCCCTCTCGTCATAAGCTTTCATAGAGGAATTTGCTTTCCCCCCGAGCTGACAGGTTGTGATGAGATCACACGTGCCCAAATTGACCAGGGT
ATCCGGTCGGAAATCACATCCGGACGGCGGATTGGTCCTTCAACTGGCGGAGGTCGCTTCCTTTCTTCGCCCTGTCCCGGATCGTCCAATCACATCACTT
CTTGGCGGTCGGAAATCAACGTCGTCGAAGCGCGATCAAATCGCAATCTCCCGCCTGGTGAGCAACAGCATGGCTCCCACTGGCACTTCAGGTCCTCCTG
CAAGCTCCGCGCAGACGCCTTCGGCGTCTCCTGGCGACGGCAGCCCCAGTGGGGGTGATGTCGCTGGCGAGTCTCCAAGCGTCCCTTCCCCAACTCCGCC
GCCCGTCGATGACGAGGAGGAAGAGGTGGAAGAGGAACTTCCGGAAGAAGAGGAAGCTCCCGATGACGCGGCGGATGAGTCGATGGATGCACCTTCGGGA
CGATCGTCGGCTCAGACCCCCTCTCGGTTACTGCTTTTGGATCGAGCACTTGCTCTCCAAGGCGAGAGCGCACTTCCTTCTGGACGTGACATCCCGCACG
ACGTCAGTTGCCGCAGGCGCGTTATGAAGTCCCTCCGGAGCACACTTCCGGTAGACAGGTCCGTCTCGTTGGGTTCCGCGACTGAAAGCCACAACGATGG
GAAAACGTTCACCCAGAACGGCTACGGCGGTCTGGAGGCGCTAATGCAGATGAATGAGTTGACCATCGGTTCTCTGGCGCAGTTGTATGATTTCTTCGAC
GAAAATGTGGACATTCACGATTACGTCTTGACGCCCCGCAAGAAACCACTTTCGGAAGATGACATGGAGCACAGTTGGTCACGTTGGTCTGAAGCGCGAG
ATCGCGAGCATTCTGACCGAATTTGGTCCGGAAAATTTGGCTCAGCGGGTCTTTGGGACAGTGGACGTCCTTCAGAAGGTGATGGCTCGTTATCGTCGGG
TGCGAGAGCAGGTGGACGATTCCAGTTCGGCTGTCCACGACGCCGTCGAAGCTCGTGATGAACTTCTGGTGGTAAAGCAGGACTACCAGTTCCAGACGGA
CTATTGGAGTCGGAAGGTGGCCGAGGTTCTGGCGGAAAAGGACGAGGTCGTCCGAAGTTCCCGTGAAGACATCATCCAGCTCCTGAAAGAGCATGCTGAT
GACAAGCGTCACTCAAGGAACAAGTGGCCACGCTCACCCGACGTCTGGACGACTCGGAAGCGCATCGCAAGATGCTGAGCGACCGTCTTCGACAGACGCG
TCTGGAAGTGGCCGATGTGATGAACTTCTTGAGTGACCACTCGCAGCTCTACTTGAACTGGCCTCGCCTCCGAGATCTCTTGGTTCACTTCCGGAACGGC
ACGCGTGTTCCATCTGGGTGGAACACCATGATCACGGTCGTTGCAAATGACGACCCGAACTTCGCACCGACGTCTTACACTCGGATGAACCGTCCTCACG
GCGACGATGACGGAGAGTTCAAGGACAGTGGTCCTCCTTCAGACGCTCTGACCGTCGACCTGACGCAAGACTCATCTTCAGGTGTGCCTGGTGGCAGTTC
ACCCAAGCGCAAGCGGTCTTCTGGAGGCAAGTCACGTGGTTCGTCCCGCAAGGTTCCAGACGCCATCCAAGATTTCCCGTCCGAATGGGACCGGACCTCC
GATGAGCAGTGTCTTCAGGACACCAGCAACATCTCGTCGGAGCAAGATGCCCACAAGATGTTGGCTGACTTCCCGGTGGTCTGGGACCAACTTCGTTTGG
ACGTCCAGATGTTAATGCGGTCTGGCGTCGGGTACTCGGGAGCGGTTGAGTTGCTCGACCAAGATCAGGTCCTCCACACCAAGTTCCCGCTCGACCCGCT
TCTGGAAATGCTTGTCCGGATGATGTTCTGGAACAAGCTGGACGAGACACCGTGGACCAAGCACGTCCCGAGACGTTACTTCCGGGCGGCTCGTGCGAAG
CTGGACGACCTTCTGGAAGATGATGTCCAGCCTCCAGTCTGGGACGCTCTGATGTCGCTGGACCAGGAAGAGGACGACCTCATCCCGGAGGTCTTCGAGC
CGGAGGTCGATGACAAGACCAAGGATGGTGACTTCGTCCCGGGTGAGGAATTTGAGCTTCCTGAAGATGAAGTCATCCCGGTCGACGAGTCTCCTCCCAA
GCGTACCCGTCAGAAGTCCAAGCGTCGTCGCACAAGTTCGTCGACATCTGGATCTACTCCTTCCAAGAAGCCAAGCGTTCCAAGCGTCGGAATGACCTGT
CCGCTACTGACTTGGCCCGGAAGGATTTCGAGTCTCTGACGTCCTTGGAAAGACGATCATCGAGACGCCTGGTCCGAGCATCACTTCTTGGATGCACTTG
GGCATCCGGGTGAAAAGAGGTGATCCGACCACGCTCTCTGCCCTCCAGACGCCGGGCTTTCCAGACTACGCTCCGAACCGGTTTGACTTGGACCTCCTGA
AAGAGCGTTGCGACGGGCAAGAACTGGGTGCCTTTCTGAACACCATGCCTTGGCGCAAGATGTTCGATGAACGTCCGCGTGAATTGTACTTCCACAAGCG
CGAAGATCTGGATGACGAAGTGCTAAATGCTCTTGACGACTGGATGGACTTCGTGTGTGGAAACTTCCGGGCGATCTGGGACATCCTGCATTGGCTCACG
CTGGATCGCTCTTCAGATGCACCGCCGGGTATTCTCAAGATTCAGACCAAGCGCGCTCGTCGTCATGAAGGTTTCCGAAAGAAGGCCTTGGCACTCCAGA
AGAAGTTGTCCACCAAGTTGCCGTCTACCATCTGGAACGAGCCTGGTGTTTGGAAGTTCCCGAACAAGATTTGCCACTGGATCCTGATGGACAAGCAGCA
CTTCAAACCAGGGACTTCCGAATGTTACTCGTTGCAGGAGCAGATGGAACTTCTGGACCGCCGTGAGCCTGCTCGCGCGCAATGGAGCTTCTGTTCCACG
GATGCAGAGCGCATCGCCCACCTCCCGGAAAACGTTCGTCGCGGTCTGATTCCTGCTGATGAGCGGGATCCAGTCACTGACATCTTCTCTTAGTCTTCCA
TTGGCAATCCATCCGGACGTCGTCACACATCTGCACGTTTTTCTCTTCCAGTAGTCTCAAAGTTAATCGTCCGAAATATACTCACTTGACTTTCCAAATG
TTCCCAATCACAACTTCCCATAGTATCCACTTCTCGAAATTCGCCACTTACAATACACACTCGATACTCACTCCAATTTCACAGCAATATAATCACACAT
TTCCAAAAGTCCGTTCGTCTGATCCATCCAAAAGGATGATATCTCGAAGGCCTAAACTCTTGGATGGTCATCACCTGCTTGCATAGTTTGGAAGCGAGCT
CTCGCACGTGCACCTTGGTTGAATTCATAGAGTAAGGCACCACAGCTCAGTTGTGTCACTGGTAACCACTCGGGTTCATCATAGCCTTTCCACTTGATGA
GGTACTCTCGGCGCCGCCTGGAAGTACGAGTACGTTTGGACCAACGTAAGTCCAAAATCTTTTCAACTTCGTACTCGTCCCTTCCAGCATCCGGTTCCCA
ACTGTCTTCTGGAAGTAGTGCAGCATCAAAGTCGTCATCTTCGTTCACGTTCAACTCCATATTCGGGCGTTTTGGAAATAGAGCCCGGGGCTTCAAACGA
CTGATGTGCACCCAAGGGTTGACACGATATCCGGTGTCCTCGATCTTGAGCTTCACCCTGAAGTCATCATGCACTTCCTCAATTCGGAAGGGGCCATGCC
ACATGTGGGCCAACTTTCTGCTCAGTCCAGGTTGGACCTTCGGATGTACAACCACACCAGGTCACCCACTTCGAACCCGGACTTCAGTCTGTCGGAAAGT
TCTTTCCACTTCTGCGTTTGCGCATCCGAACGGTGACGCTTAGCTTTCTTCTGTAGGTCTTCTGCACATGCTTTCGCATAGCTGTAGTCCCGTTGAAGCT
TTCGTCGCCACTCATAAGCGGTCCTCTCCTGAAGACTTGATGGCTTCGGACCCAACATTGCAGATAACGTCCCTTGGGCATCCCATCCGTGAACCAGATA
AAATGGCGTGTCCAGGCGAGTTGCGTCGAATGACGTATTCAGAGCGAACATGAGTCTTTCTGAATGATCGTCCCAATCGCTCTGATCCGCTTCCGAAATG
TACGCTCGGATGCTCCTGACCACCGTCTGGACGGACGCTCCTGTTGGCCATTTGCCTGGGGACGATATGCCAGTGTGGCGCGCTGTCGACTTCCTAAAAG
TTCTCGGAAGCGGTGAACACCTCGCTCATAAACCTTGGGTCTTGATCGTGACGCAACATCGAACTTGCTCCAAACCTTCGGAAGACGCACTCTTCGTAAG
CTTCCGCTACGTCCTGAGCTGTCGTCGAACTCATGGGTTTGCACATGACGAATCCGGAAAACGTATCTTGGAACAAAAGTAAAAAGGTGTTCCCACGCTC
GGACTTCGGCATGTGCGTCACAAAGTCCATCGATACAACTTCGAAAGGTCTTCTAGGTTCGATGTTTCCAGGCGACGGACCAGCATTCGGAGGTCGTCCC
TTGCCGCTGGCACAATCAACACATTCCTTCACATAGCGTTCCACATCCGCATACATACCAGGCCAATAGAATTCCGAACGCAATTTCTCGTGCGTCCGAG
TGATGCCTTGATGGCCGCCCTGATAATCTTCGTGCGCATAGTGCAGCATATCTGGACGGAGTGACTTCGGGACGACCAGCCTTGGCTCATCCACAAAGTC
CCTCGGGCGGTCTCGGGTAGATCGTGCAAGTCGGTACAGCACATCGCGAGTGTCGAGCGCAAACAAGTCAGCAACTTTGGCAATCTTTCGGAGGCGTCTG
GGTGAGAATCTGTCAACTTCACCCTTCAGGAAATCTTTGATCTCTGACAAGTACTCGTCTTCTTCCTGATGAACTTTGATGCGACGCCATCTTTCCGCTT
GGAATTCCAGAGGTCCCATTGGTGGTCCATCCAGAGATTCGGTGGTTTGAAGGCCTGACCTCGTCATGACTGCCATCACTCTGGCGGCTGCCGACAACGG
GGCAGAATCAGCATCAGGAAGCACCGTTCCTACCTGAGCGTCCCTCGCATCCGAGCTTCCGGGTCCCACTGGACTGGAACTGTCATCGCCATCTGGAGTG
TCAGTCTTCGTGACATTTTCGGGTATTTTAGACACTACTTCCAGGTGTTGGAGCTCATGTTCATCTTGGACTTCCCATGACTCACCCAGTAGCAACGTCT
TGGAAGTCAAGTAATCGGCGGCTTGGTTGTACTCCCTCTTGAGGTGTGCCAGCCTTACCGTCCGGAACTTGGCCTTCAGAACATTAGCCTCCGCGAGATG
CTTTTTGCAGGTGGGGCTGATTGCAATTGATCAGTCCTTGCACTTGCTGAATAACAATCCGGGAGCCACCGACCACGAATAGATCTTCGACATGCGTTCG
GAAGCCATCGCCATACCTTTCAATAGTCCATAGTACTCAGCGTCATTCACAGTAACATCTTTCAGAATATAACCGTGTGCTTCTAGAACGGTCCAACCGG
GCAATGCACCCGCAGCTTCCTTGACGAGTCGACGTCTTGGCAGCTCCATCGAAACTAAGGACGATTCCATCGTAATCTGTATCCAACATATCAACACTCA
CCACAGGCGGTTGCCGGATCTCCCCTTTCGCTGGAATCAGTGATTCAGCATCTTTGTCTAAATGTTCACGCGGAGTGATCCCAGCGCCCATGATAGCAGC
CAGACCGTCCTCGTCCCGTTGAAACTTCCGGATTTCCATGTTCCGCCCGGATAACGCAAGTCCCCATGGAACGCATCTTCCGTCGGCAGATTTGGAAGTG
ATGACCCACTTCAGAACGGAGTACCTTGTGTAGATGATCAGTGGACAATGTTCAACGATCGTCCGGAACACCTGAAGCACCCTCATGATAGCGATCACCT
CCTTCTCGGCGACATGATACCTCACCTCGGAATCGTTGAGGACGCGACCGGTATACCTGACTGGATGTATCCTCCCATCATATTCTTGCCCGAGGACTGC
GCATGCAGCCCACGGATTGGCATGCGGGATGATGACAAACGGTCGGGAGCGATCTGGATGGCGTAGCAACGGAGTCGAGACAATCTTCCGCTTCAGGATT
CCAAAGGCTTCCTTAGCTCTTGATAGATTACGTCCTGAGCGCACTTGGTCATCCGAGAGTTCATACAGCACCGCAGCTACCACTGGAAAGTCCTCACTAA
ACTTGTGATAGTAATTGATACTTCCGAGGAACGATTGTACTCCTTTCAGTGTGCTTGGGAACGGCACGTCCTGAACGCCTTTCGCGATTTTAGGTGTCGC
CCGGATGCCTTCAGCACTAATCTCGTGTGACAGATACGGGATCGACTTCTTTCCGAACTCACTTTTAGGGAGGCTCACAGAAATATTCCAGTACCTCAAC
CTGAAAAGGAGTGCGTTCAGATCATCACAAAGTTGGTCCCAGGTTTCAGCTCCATGTGCAATGTCGTCGATATAGGAACTACGTCCCAAGACAGGACCCA
TCTGAGATGGCGCAGGGATATTCCTCTTGAACACAGTCATGTACTCAGTCAGCGTCGGGACTTCGGGATTAGTGTCCACATCCAGAAGATTGGCTTCCGG
AGGGGGCAACTTCAGGAAATCCAAGACGTCTTGGTCGACTTCAGACTCTTCCTCTGGAGGCAGCCGGACGAATCCCCACAGGCAGTTATTAATTACTGCC
TGATACACCAAAGGCGCGTTTTTGAGTCCAAACGGCATTCGCACCCATTGGAAGTGTCCAAACGGACACACAAAAGCCGAAATCAACTTGGCACGCTCTG
ACATCCGAACCGCCCAGAATTCACTAGCCATATCCAAACTCATGAACCACATTGCGTTCTCAAATCCGACCAGTAAGCCGTCAATCAGCGATAACAGGTA
GTTCGAAAGTTCGATAAAACCATTGACGATCCGGTAATCAATACGCATACGGATGTCCAGACCGTTTTTCTTCAGGACGATTACAATCGGAGAGGACCAT
GGTGATTCGGAAGGTTCGATCAATCCGGTTTCCAAGAGTTTCTTGAGTAACTCATAGACCTTGGTAGCCAAATGGGGTGCAATGGATCGGGCGCGTTGTG
CGACCGGCTTGGCCGTCCCAACGTCCAAATCACAAGTCACAAGTCACTCCTCTTGCTGGAGCAGGAGCAGCATTTCCGTCACCCAGAAAGATAGAGCGGT
GGTACTTCAGGATGGACCGAAACTTTTGCTCTTCCAGAGGTGATGTCGTTTCCGAATCCCCCACATCAGCCGCATCAATATCACATGTCGGGCTCAACTC
TTGGAGTTCCGGAAGCATCGCCAGCTGATCACGCAATTGGGCTAACAAGTCACTTCCTTCATGAATGTACACAGCGGATTCCAAATCCAGTTCTTCTGCG
TTCAGACGCATGCACCTCTCATACTCGACTTTCAGCTTTGGATTGGGGTAGAGAGCATGTCTTGGGTTCGCTGATCCCGGAGTTCGTCCAATCCTGACAA
GTCATCCAGACAATCGTTCACATCGTCAGCACCTTCATCCGGAAACTCTTCATTCAGGCTAATCGAATCAAAGAATTCATCTCCGTCCGAATCCACGTCG
TCTGTCAGAAGTTCTGCGTCTTCCAAACGTTCTTCAACCCTTGGTATGACTTCCGACTCCCTTGGATGACATCCGTCGCCGGTATCTTCCGGACGTGGCA
TTTCCTCAACCTCAGGGTCCTTTTTCAGCTTTACCGTGTCTTCTGCGATGACTGCATCTGGAAGAGTTTCCTCCACTTTCGGGCGTAAGACTCGAGGCAG
CTCCTGAAGTTGCACCATGTGAACTTGGTCGCTTCCAGGAAGCGGTCGAATCAATAACTTAGTCGGCCATGAGTACTCGGACTTCTGGACGCAAGGAGGT
TCGGCGTCCCTCATCATCTGCTCAAATCTATCAGACCGTAAACGCATCTGATTGGATTCAGTATTCTCATAGATGAGAGTCTGCCACTCCTGATACCTTC
GGAGACCCGGGCGGACAAAACGTCTTGCCCTCGGGAAGAAGCCAAACTCGATGATCCGAGCGTCCGAGTGTCAATGCTAAGACACCTTCCGGAAATGTTC
ACCACTTTGATGGCCACAGCCCACGATCTAGCAGCATAGATGATCTGAGTTACCCATCGGTCTCCCCGACCAGCCCATACCACATCACGTTGTGGATTGC
TCTGTCCGTAATGTATCCGGACGATAGCATGTTCACCTGGACGCAGGAAAAGCTCTTCACGCGGTCTCACCGGAAGGTCCAAACCTCTGTGGTAATGATC
CGCACCACGTCCTGATAGCAACACAGTTTCTTCATCCGGAAGTTGCACCAATCCTTCTCGTGCGCACAGTCGCACTCCAGCGGAATACATGAAATTCATT
CCAAGCAACACGTCGACACCTTCTCCAATGTTCGCGACCCAGAGCTCCAAGACATACACAATTCTTGGACCTAAAGTGATTTTCACTTCAGCACTCGCGG
TGATGATGGTCGGAACGCCACCCAGTCCAGATACCCGGAGCTGTTTGCAGAAGCTTAGTTTGAGTTTGAGTCTACGCGCAAGATCCAAACTCACCATGCT
TACCGACGCTCCGGAATCCAAAAGGATGTCTGTCCGGCAATTGTTTACCGTTCCATGAACCATCGCAATCCGTTTCGTGTCATCCGAACAGTGATCTTCC
CACCAGCCATATCGTTCGCCTGGTCCCAGTCGGAATTCAACAGGTACATCCGGATCTTGTACTTCCGGCCGTACACCTTCCGACAGAACTCGTTCAGGAC
GAAGTTCATCTGAAAGAGGGTCACCACTTTCCGGAGTCACGGTCATGCATTGATGTTTATCCTGTTTTTGGCGTCTCAACTCCGGACCAACATACACTAG
AAGACACATATTGGGGGGTTTCTTCAGCCCGTCGCGTTCTGGATCCCCATCCAGCGGGCTTACTAGTTTAACGGCTGTTCCCCTGGATCCACCTTCCCTT
CCAGAAGTTGCTTCCGGATAGGAGACGTGTAGCGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGGATACATTCAGGTGACCA
CTCCACAGGATGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATAAGAGTCATTCAATAGATAGGGGTTCTGCCA
GCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCCGTTTG
GTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCATACACGTGCGCACACGTGTAAGC
TTAAGTAGTGGGTCTAAGCAGACCCATTACAAGACGGCAGATCTTTCAGTGCTCCTTGACGTGCAAGATTCTTGATCGTTTGGAAAGCTTTCCATTCTTC
ACACTTGCCTTCGTGAAATTGGTTACAAATCGCACACGGACGAGTCCTGCAGAGGTGTGTCGGATGTCCCATCCGATGGCATCGATCACATTCGATGTCC
GACCAACAGTTCTCCGTTAGATGTCCAAACTCCTTGCACTTGTCACAGAACTTGGACGCGTTCGGACTTCCAAAACGTTGCTGCCGGCGATCCGAACGGA
AATCAGCAGTCGGTGGCCGCCATCCGGGATTCTCCATCGCACGAAATACTGCTTCGGAAAGGTTATCCATGCTCGAACCGGACACGTTCGTGGCATCCAC
AGTTGGAGTAGTCAGCACACTCGGAACATGTTCTCGACTTGTCACTTCTTCCACATCTTCCAAAAAATGGACTTGTCTGTCGTGCTCGCCATCCCGGTTA
TCGTCATCGTGAAGGACATAGGATCTTCCAGAACGTTTCGGTCTGAATCGATCACGAGGGACATTGTCCGCTCGGAAGTCTCTCTTCGGAGGTGGAGTAT
CGTAGTCGTCGTCTTGATTCATTTCTTCATGCTGTTTCAGGACATATTCCAGGTCCTTCAGACGACGCAGACGTTGTCCTTGCAAAGTCGTTCGGAGGCG
AGAGTCCAGACGTTTCTTCGTGAATACTTTCAGATGGCGCTCACGTTGCTTACTCGATGCGTCGAACTCGATCCCAGCTTTGTCGGCCACCTTGTTCAGG
CGGTAGTAAAATTCCAGCGGGGATTCTGCCTTCTTTTGGATCATCGTGTAGTAGCGTTCTGAATCCGAGGTCTTGGCCTTGCAATACATATTTCGGAACT
CCTTCAGGAACTTCTTCCATTTCCGGCGCACGTTGGGATTCAAGTTCGAACGCCAGTTTCGAACGGCAGCAGGTAACTTCAGCTTCATCTCATAGATCTT
GACCTTATCCGACCAACCACCCTGAACGGCAAAACTCTTGAATCGTTCTAACCACCGGATACGTGTAGCTGGTGACGTCTTCTCATTGAAGTCTTCCAAC
GTGCTGACATTCACGTATGGTCTGAACGTAAACAGAGATCCGCCTGGACCCGGTGTCGTATGGACATTCGGAACGACATCTTCGAAAGAGCTGCTATTTG
AACTGTCAGAGTCAGAGTCACCCCTACTGGAGTCAGAACTTGGATCAGAATCCGAAGGGTCACTTGACTTTCCTGATGACTTCTTCGTCCACTTCCCTTT
TCCGGAAGCCGAACTTTTCTTGGACAAACCAGACTTTTCGGAAGTGTGTCGCTTGGCTGACTTTCCGGGTGCACTTGACTTGGTTCCAGAGGACGACTCG
GCCTTTCCAATTGCAGGCGTTCTACTTCCAGATATGGGTTCCGCTTTCATGTTCACAACAGGCTCAGAAATCTTCACAGCTTTCCCCATCAGGTTGTTCG
AAACTCTGTCAGCAGCAAATGCCTGCAAAGTAGCTTGCAATTG