Description :
From Genome Similarity Track
Location :
Scaffold_29:4678- 6760
Transcript NameFunction/comments
Phypl_g1175hypothetical protein PHYSODRAFT_350634

Sequence
2082 bases(100 bases per row)
CATGCCAAACGTAAACTGGTGCGCGCCGTAGTCCATGTCGGGTGCGATGGCGaagtcttcctcgtcttcgccgtcgaaGTAGTCGCGGATAATACGCACA
GATTTCTCGTAGATGTCTGCATTGCATTCAAAAGCATCAGGAATCATAAGTCAAGTCACTGTGCTAAAGTCAGCTtttgacgctgctggaggcaacgcac
cttcttcttggtggtACTGCAGGTTCTGGATGAGCTCCATGCCGTCCGCTTCATCAATGTATCGCGCCATGCGATTCTCGGTATCCGACAGCGACATATC
TGCCTCCCCTGCCCGAAGAATGTTTTCCAGAGCGTCCAAAGACACGTTGATCACACGTGGGTCCTGGACGTCCAGGAGCTTAACTAATGGAGGGATGCAT
CCTGCAGTAAACAAACACGCATGATAGTTAGTTAGTTGTTACACAGCTGCACATAGAGATCATCACGCTATGAGCCAGCCGTACCTTGCTGTACTAAATA
TTTGATCTGCTCTGTGGTGCCTCCGGTCGTGGCATTCGAGATAGCCCAGGCCGCTTCTTTTCGGACGTCGAACTCAACCGACCACAGCTGGGCCAGCAGG
GGTGGGATCACGTTGGCGTCGATTACTTCCTGAATCTGGCTCGGGGTACCGGCGGTAATATTGGAAATCGCCCAGCAGGCCTCCTTCCGGATGATTTTTT
TCtcgtgcttgagcagcggTACAAGCCGCGGCAGCACGACCAGGTCCAGCATCaactgcgtctgctgctcatTGCCAGTCACAATATTGCCGATcgtgcg
cagcgccggcgtctGAATTGATGTTAACGTGTGTCCCACCAGATCCACTACCCGACTACACACTCCAGCGTCAATAACGGCCTGAATAGTCTCCGTCGTG
CCGTCCGAGAGATACGAGAGCGTCCAGCACGCATCCGTGACAACTTCCTCATCCGGCGAATGAATAAGGTGCggaagcagctgcagcgctgggctAACAA
AAGCAAATTCTGGTCTGGGCTTGCCACGGCAAAAGTTCGACAGCGTCCACGTTGCGTTTCTGAGAATCGTCAGCTTTCCCGACGACCTTCGCAGTACTGC
CAGCAACGGCATCATCGCGCCCGCATTGAGCACCAGGTCGCGGCATTGCGGGGAATCGCCCGAGATGTTTCCCAGTGCCCATACGGCCTGTTCGCAGACG
TCTTCATTTGGAGAaaacagcagcgcgcacagcagctccaccgcgCCGCACCTGATCACCTCCTCTGTGTGCTCTGTTGTGCCCGACGCGATATTCGTCA
GCGCCCACGCCGCCTCGAATTGCATCTCTGGCCGATCATGCTGCTTCAGAAACTCCACAAGCAGCGGGACAACGCCCAGGTTGATCACCTCCTGAATCGG
CGGGTTGGTCTCTGtccacaacaacaacgcaGCGCTCCAGCCATCAGTACACGTCCACGTCTCTCCACAATCTCCACACACCGCGTACCGAGCGACAAGA
GCCTTCTCAATTGGGACACCGCGTTCGCCTGCTCCATCGGGTCCAGCGACTGGATCTTCGCCGCAATCCTGGGCAAGTCCGACACCTGCCCCACCAAACA
GCCAGCCAATATTATTATCTCTCCGTCCACTACGTCTTCTGTACTGTATCAGTCACCCCAGCAAAGCAGGGCAAAGCGTACACTGACGCCGTTAAGGGAG
CGCACGGACACGTCTTGActggcgctcgtcgtctgcatCGGCGTCTCCGTCAGGTGCATGGCGCCAGCTCCGTTGCTGCGGTCCTGCCAGTTtaacaaac
aaacaaacgTTAGTATCCATACGGTACTACGCACTACCAGCTGTGCGTCTCTGTATGTTTGTACCATGGGAATAATGCGCCTCCGCTGGTTGAGTCGCTC
CTCGCGCCGCGTCTTGCGGATCTGAACGGTGGTGTCCTCGCGTCTCCGTCGGGTCTCGTCCGCATCGATGCCCTTCTTGAAGCTGCGCATGCGGTCGGCG
ATGCGCGCcgcggaggagacgctcgtAGCCATGCTCTGTGTCTTGTGGACTCGcctggcgatggcggcggtgctggtgcccG