Description :
From Genome Similarity Track
Location :
Scaffold_1793:4678- 5838
Transcript NameFunction/comments
Phypl_g14160hypothetical protein

Sequence
1160 bases(100 bases per row)
TTTACCATTCTCAAACTTACTCTCTCCACCTCAAGTCGTCCAAATATCCCTTTTCTTACCGACCATAAACGACTGGCTCAAGAATCCATAACCATGCAGC
TCCTCGCACCGATCGTTGCGGCATTCGCGCTTCTGTCCACCGTGATTGAAGCCAAATCTGTCGAAGAGACCAAGTCGATTGACGAGCTGTACGCAGACGC
TGTGGCTGAAGGAGGTAACCTCGTCATGTACCACGGAGGTGATACACCGACCCAGCAAGACCGCCTGCAGAAAGCCTTCTCACAGCGCTTCCCGGAAATC
AATTTCACACTCATCGTTGACTACAGCAAGTACCACGACGTACGCATCGACAATCAGCTGGAGACCGACACTCTTGTGCCCGACCTTGTGGCGCTGCAAA
CGCTGCACGATTTCCCACGCTGGGCGAAGGCCGGCGAACTTCTCGAGTACATGCCCGCCAATTTCTCGCAAATCCACGAGTCGTTGGGGGACAAGAACGG
AGCTTGGTTGGCGTACACGTTGCTCACATTCGGCTACATCTATAACTCGAGCGCGCTTAGCGACGGTCTTGCTGCACCCACTGCTCCTACCGATCTGGTG
GACCCGCAATGGGCTGGCAAGATTGCTTCATCTTATcccaacgacgacgatgctgtGCTGTTCCTCTACACACGGTACGTCAAGGCATACGGATGGGACT
GGCTGGCCAAGATGGCTCAGCAAAACATTCGTTTCACCGTGGCACAAACGTTGCGGGCAGTCTCGTGAAGTCGGGTGAGAAGGTGATAGGTGTCGGCACC
AGTGGCAGCAACTCTCCGATTAAGTCTGTGGGCGGTAATGGCACTGAGTATCTGAGCTGGGGTCAACGTGTTGGCATCTTGTCGAAGGCTAAGCATCCTA
CCGCTGCGAAGCTGTTCATGAACTGGATCGTAACGGAGGAAGCCCAGACGTCGGTCGTGTATTCGAGTGTTCGCACGGACATCAACTCTGACAATCCCTG
GGATATCCCAGAGGCCAACATGGCTGGATTCCCCAAATTCATGGAAGATCgtgcgacggcggaggaATGGCGCCAGACGTTCACGCTATACATCGGCGAA
GTTCAGGGCAAGCCGTCGCCCGGCTGGCTTGGCCTCCACCCCGGTCAGTGAGAACCGTTC