Description :
From Genome Similarity Track
Location :
Scaffold_20:46772- 53972
Transcript NameFunction/comments
Phyci_409227Hypothetical protein

Sequence
7200 bases(100 bases per row)
ACAAAACTGAAATTGAAGTGGCGAAAGGGTGCGATCCATCGACGGTAGCATTGTAGCATGGGCAACGCGCTGCTGCTCGCGGCCGTGAAGGACCGCCAGG
CCGTGGCGCTGGCCGACGCCATCCTGCCGTTCGACAACCTGCGGCTGCATGAGGTGGAGGCGTTCTGGCGCGCGTTCTACGACTCGGCCACGAGCTTCGC
GCTGTCCAAGAGCCAGCTGCGCTCCATTTGCTGCCGCGCAGTCGCCGGCGGCGTCTCCAGTCTGCAGGGCTCCAATGCCCGCGTCGCGCAGTACGCAGAC
GCCGCCTTTGACCTGTTCGCCGACCCTTTCATGCAGAGGAGGTGGCAGCAGCTGCAGCCTAGCGATCGTGTGCTGCAGAGCCAGCAGTACTCGAGCTCGA
GCGACAGTCTGGCTGCGATCGACGCGCTCGAGTTCCTCTCAGCAATTGCGTTCATAGCTGCAATCCCACTGGATGAGAAGATTGACTTGCTGTTTGATTC
GTGGGATATGTCGGAGGACGGCGCGCTGGATCTGGACGAGTTCACGATCTCGTTGAAGTCGACGCTGGCGGGACTGGCCAAGATCATACAGCCGGTCGCA
CCTAGCCTCGCCACTAGGACGACAAGCGTGGATCCCGTGGTGGATGAAGAGGAGATTATCCTCCTGGCGGAATCGAATTTCCGCGAGATCTCCAATTGTG
GGGCTATTGTGAAGGTTGAACAGCAGGAATTGGTCACTATCACCTGTGAGCAGTTTCGAGAGTTCTGCGTGAAGAACAAACGAGCCAAGGAACTATTTGA
TTTGTTTGATGTAGCAGATGCCAGTCCCGAAGATGGTGGTCTTGCATATGGAGACGCGGGAGGCGTGATGGAGGCTGCTGAAACTTCCGAGTTGGCGGCC
AAACTGGATAAGCACTCTGAGCCCTCAGATTCTACGACTGTTGCGGGTGTACCAGTGGACGCTCTGCAAGATGATGTTGGCGACATGTTTTTGGCAGTAA
AGCCATGGATCGGGGCTATTGTGGCTCCTAGCAAAATTCCACCCCTCTCGAAAGGAGCCCCGCTGGTCTCAGTTCAGTTGGACTGGATATTTGGCTATAG
CGCGCAAGATTGCAAGAATAATGTACGCTTCATCTCAACTACGGCTGGTGCTAAAGCTGGACGCTTTGAAGAGATAGTATATCCTGCCGCTGCAGCATGC
GTTGTTCTAAACACGAAAACTATGAAGCAGCGCCACCATCTAGCCCATACCGACGATGTGCTGAGTTTGTGTCTACACCCTCGTCTTCCCCTCGCTGCAA
GTGGAGAAATCGGCAAACAGCCCAAAATCATAGTCTGGGACCTAGAATCTATGGAAGCACAATGTATTCTACAAGGGTTTCACAAGCGCGGCATTTTGCA
GCTAGCTTTTCTGACCCCCGAGATGCTTGTATCAATTGGAAGTGACGACGATCACAGCATCGCAGTTTACGAATCGAGCAACAACTGGAAATCTGCTTCA
TTGAAAATCTCAGTGAAAGGCAACAAAGCAGCCCCCTTTCACATTACTACGAACCCTAGGGTATCAAATGAGTTTGTTGTGTGTGGCCCAAAGTACATTG
AGTTTTGGACCCTGGAAGGGAAAGAACTTGTCTCAAAAAAAGGTTTGCTGGGGAAAAAGGGGTCGTTGCAACCGTTTCCTGTGGCACAATATCTCGAAAC
AGCCGATCAGGCTGTAGTTGTTGGGACAAGCGATGGTTGCTTGTATCTTTTTGTTGGACGGCAACTAACAAATGTCATAAAGGCCCATGGCGGGGCAATT
ACTGCGCTGTTTTACTCATCAGGGCTTTTGTTATCGGGAGGACGAGATGGTGAAATCGCTCAATGGGATGATAAACTGAAGCAAGTGGGGCCCCCAATAC
AGATTCAAAATGTGCTTGAATCATCCTCGCAACCTCAGCGAAAATCAATTCGAAGCTGTTGTTTCTCTCCTGACAGAAGAACAATTCTTGTTGGCACCCT
AGCGTCGGAAATTTATGAGCTAGACGCGAAGACTGGTCAAAACATCCACTCGGAAGCTCTTATCCAAGGGCACTTCCAGGGGGAATTATGGGGATTGGAT
ACTCATCCAACGAAACAGCAGTTCTCTACAGTCGGAGATGACCAGACACTTCGCGTTTGGGACTTGGTAGCGCGGCAGGAATTGGGTTTCGTAGAACTAC
CAATTCCAGGGCGAGCTTGCGCTTACTCTGGAGACGGTAAACTAATCGCAGTCGGCCTTGGAACTGAGGACTCCGGTAAACCTGGAAGTGGGTCTCAGTT
GAAAGGAGGCAATGCTAAGACACGGCAGCCTAATGGAGGTTTCGTGGTTTACAGTGCTATTGATTTAACCTGTGCAAAGGAGGCCTGTTTCGATGCAAAA
CGTTGGGTAGGTGATATCAAGTTCTCACCCGACAATCGAACCCTAGCAGTTGCAAGTCACGACTCTAAAATTTATCTGTATAATGTCTTGAAGGGTTTCT
CACGAACTCACGTATTTAACAAACATTCGAGTTACATCACACACCTTGATTTCTCGCTGGACGGGAATTATTTGCAGAGTACCTCGGGTGGGTACGAGCT
TTTATTTACCGAAGTGAAAACTGGAAAGCACATTACAAATGCCACTTCCTTCCGCGACGAGTTGTGGCACAGTATGACCAGCACGCTGGGGTGGTCCGTA
CAAGGAATTTGGGAGCCTGAAAGTGATGGCACAGACGTAAATGCCGTCGATCGATCTAACAACGGGAAACTGCTGGCAACAGGCGACGACTTCGGAAAGG
TCAAAGTTTTTCAGTATCCTTGCGCCCTGGAAAAAGCATCGTACCTTGAACTACGCGGGCATTCTTCCCATGTCACAAACGTGAGATGGTCTCCTGATGA
TAGCTGCATCGTTTCAGTTGGTGGAAACGATAGATGCATTTTTGTCTGGAAGCACGATAAACAGCCCAAAGGAGAAGACAACCTCAAGCGTCGCTACAGC
GAGACTGACAGCGACAGTGATGGGATCGACTTACTCAGCAAGAGAGCTGACGATCCATTGGAGGTAGCGGCGACGAACGATGACATCGGTGATGAGTTTA
TGGCGGTACGCCCTTGGTTAGGAGCTGTAGTCGCTCCATCGAAAGCTGCGTCGATGAAAGTGGACAGCACATCTCCGCATACCAGGCTAGAACTGGAACG
GGTTCATGGCTATCAAGCTCAAACCGCTTCAAACAACGCGCGATATGATTCGAATGGCAAGGCGGTGTATCACACTGCGGCGTTGGGTATTGTGTTCGAC
AGAAGTTCTCAACGTCAGGCATTTTTCAAGAGTCATGACGATGATGTTGTGGCACTGTGTGCTCATCCGAATGGTAAAACGTTCGCAACTTCACAAATGG
GTAAAATCCCTAAGATCTATGTCTGGGATTCGGTTAGTGGAGAAGCTGTAGCACCCTGTTTGGAAGGATTCCACCAGCGTTTTGTGAACGCGATATGCTT
TTCAAGCGATGGTACAAAACTCGGAAGCGTTGGTGGCGACGATGATCATTCCATTGCAATTTATTCATGGCAGACGGGAGTATTATCCTGTCAATCTCGC
GGTGAGCGCAACAATGTGCGCGGAATGTGTTACCATGCTGCTACGAAGGAGTGGGTTACGTGCGGCGATAAGCATATTCGTTTTTGGTCAGAGCAAGGGA
AGAACCTCACATCAAAAAGGGCAATTTTCGGGACGAAAGCGTATCAAAATGGAAAGGTGCCGTCGGTCTTTGACTGTGTAGCCTCTTTCGGGCAAATGGT
TATTGCGGGTGGTTCGAGTGGACATTTACTCGTATTTCAAAGTTCTGTAGATGTAAGTAAAGCAGTTCTTGCTCATGACGGAGCTGTACTGGCACTGTAT
GCAACTGAAAGAGAGATCATCAGTGGTGGAAAGGACTCGAAGATTGCAGTTTGGAACGACCAATTAAGCAAGGTGGCTGTTTTTGATATGAAAGAGTATA
CGCTACAGGGGGCTAAACTGTTAAATCCCGAAATTCGGAGCGTTTGCTCCAGTCAATCCTCGCCTCGAGTATTCTTAGTTGGTACTGGAGGTAGTGATTT
ACTTGAGCTTGATGCTAGTCGAGCACAGCCAACGTTGTCAACAATTACGCGAGGGCATTTCAAAATGGAGGTCTGGGGACTTGCTTGTCATCCAGCCAAG
CCCGAGTACTGCACAGTTGGTGATGACCAAACTATTAGAGTTTGGTGCCTGGCTAAAAAGGTCCAGCTGCGGTTCCAACGATTAGAATGTGCTGCTCGTG
CCTGCGCTCTAATGGACTCGGCAGATATCGTCGCAATAGGGTTTGGAGGGCGTAACGCTAGTTTATCGAAAACAGCACAAGCGAAAACAGGAGGAGTCGT
AATACTTTGCTATAGTGACTTAACGAAGAAGGTGTTCGAAGATCGACCGTCCAAGCAAGCTATTAGTGAGATGAAGTTTTCACCGAGTGGCTCCGTTCTT
GCAGTCGGATCGCATGACCATAATATTTATCTGTATCGTCTTGATCGGAATGCCACTAAGGTGGCCAAAGCAGGAGTCTTCGATAAACATCAGAGCTACA
TCACCCACCTTGATTTCTCGGCGGATGGCCAGGTGCTACAAAGTAATTGTGGTGCCTACGAACTCCTTTTCAGTAACGCTACAACAGGCAAACACATCAC
GTCTGCGAGCAGCACAAAAGATACACAATGGCACTCATGGACATGTGTACTTGGGTGGCCAGTACAAGGCATTTGGCCACCGTGCTCAGATGGGACGGAT
GTGAATGCAGTTGCCCGGAACTCACGCGAAGATTTATTGGTCACCTCGGACGACTTTGGTCTAGTCAAGCTTTACCGATATCCTTGTGTCACAAAAAATG
CAAGCTCATTGGAATACCGTGGGCATTCCTCTCATGTGACCAATGTGCGGTGGTCGTATGATGATGGCTATGCCATTAGCATCGGGGGAAATGATCGATC
GTTGATGGAGTGGAAAGTATTACGAGAGGACGAACGTATCCCGACAGGGCCAGCGAAACAGTTGAGTTTGGTAGAAGCAGAGGAAACCACGGATTTGTCA
GCCGAATCGGAGGAGGAGGAATTTGATGATCCTGCGGGTGATGAGTTCATGGCGGTGAAACCTTGGGTTGGAGCAATTGTCGCGCCAACAAATGCCGCCA
CTCCGAACTCCCGCGAACCAGACATAAGGCCTGAGCTTGAATGGGTATATGGCTATCAGTCTGAGGCGTCGCAACAAAACCTGGTATACAACGCGCAGGA
TGAAATCGTTTACCACTCGGCTGCAGTGGGGATCATCTACGACTCGACGAATCACTTGCAAAAGCACCATGTCGGCCACAACGACGATATCATCAGTTTT
GCTGTGTGCGACACTAAACGCAACCTTATCGCAACAGGAGAGCTTGGGAAAAAGCCTGCTCTGAGGATATGGGATGCCCACACGGGTGAGCTCCGGTGTG
AAATGAAGGAGTTTCACGCACGCGGTATCGTATCACTAGCGTTTAGCGGTGATTCTACGAGACTGGTTAGTGTGGGAGATGATGATGACCATTCGCTGGC
AGTTTGGAGTGATGCGAGCAATGGGTCCTGGACATTGGCAAAACTTTTGGCTACAGGCAAAGGCGATAAGGCGGTGAACCGCTTTGCTTCATTTGGGACA
AGCGCCGACACTATTATCACTGGGGGTGTCAGACACGTGCTGTTTTGGACTGTTCAAGGCAAAACCATCGTCTCGAAAAAGGGAGTAGTTGGTAAGCAAG
GAAGTATTCAGACGTTCCCGTCAGGCTGCAACTTTGGAGGGGACTTTGTCACAGGGACGGCAGGCGGTGAGCTGTATGTCTGGCGGGGGAGTGATCTTTC
TAGAACGGTCAAGGCACACGACGGAGAAATTCGAGTAGTGGCTAGCACAACCCTCGCTGATAACCCTGCTGGAAAAGCCCCCGTGCTGCTTTCAGGTGGA
AAGGACGGTCGCGTTATCATGTGGAGCTCAACGTATCAATCGCTTAAGTGCTTCGATCTGGACGCGTTACACATCGGTAGCTTCGGAAGAATCATCAACA
GCGTCTTTCTAAGCTCCAGTGGTAGAAATCTGCTTGTTGGCACTTGCTCCAGTGACATCATCGAGATCGACGTGGCAAGCGGCAGTGTTCTGAATAGCGG
ACAACCACTGTTCTCCGGCCATTTTGCATTGGAACTCTGGGGACTAGCAGTGCATCCTTCTCAGAGGCAATTTGTGACAGTCGGAGATGACCGTACATTA
CGCGTTTGGGATATGGACGCCAAGCGTTTGATCCAAGCGCGTGCCCTCCCTGCGAAAGCTCGTGCATGCGCTTATTCACCAGATTCTGAGCTGGTAGCGG
TGGGCTTCGGTGGTGACAATGGTGTACGGCAAAGGAAGAAGCCCGCACCTAAGCAGGGGCAGACGCAGTCGAGAGAGGGTGGCTTTGCTGTTTTCCGTGT
ACGCGATCTGGATACCGACAAACTCGTGTTTGAGGATAAACCCGGGAAGGAGTGGATCAGTGACATCAAGTTCTCACCCTGCGGAAACATTTTGGCTTTG
GGATCTCATGACAACTCCATCTACCTCTACACCGTTGGTTCTGGGGCGTCTGAATTCAAGAAGCGCAAGCCGTTTAGCAAGCACAGTAGCTACATCACGC
ACTTCGACTTTTCAGAGGACAGCAACTACCTGCAGTCAAACTGCGGCGGGTACGAGTACCTATTCTGCGATACAGCATCGAGTAATCATGTGACCCGAGC
GTCATCTCTACGGGATGTGAAGTGGGCGACCTGGACGTGTACTTTGGGCTGGCCCGTGCAAGGCATTTGGCCCGAATGTGCAGACGGCACTGACATCAAC
GCCGTTAGTGCATCTTCATCGCGTACGATTCTAGCGTCCGGGGACGATTCCAGCAACGTCAAGTTTTTCCGCTATCCGTGCATTCCAAAGGGGGTACGTA
TTGCAGCCCTAGGAAACTACAAAAGCCTGACGTGCGCTCACTCACTCACTCATGTTGTTCTTGTATCCGCAGTCCAAGTTCATTGCATGCCGAGGCCACT
CGTCGCACGTTGCGAACGTGCGCTTCAGCTTCGACGACAAGTACCTCATCTCCGTCGGTGGGAACGACCGGTCGATTTTCCAGTGGAAGCTGTCGTAGCC