Description :
From Genome Similarity Track
Location :
Scaffold_1:46772- 68025
Transcript NameFunction/comments
Phyta_totarag16U3 small nucleolar RNA-associated protein 18
Phyta_totarag17hypothetical protein PHYSODRAFT_310464
Phyta_totarag18Ca2 :Cation Antiporter (CaCA) Family
Phyta_totarag19hypothetical protein
Phyta_totarag20conserved hypothetical protein
Phyta_totarag21hypothetical protein

Sequence
21253 bases(100 bases per row)
GAAGGTAGTTTAGGCAACCACGCCCTGGCTGCTAGCGGTAAATACTACGCCGCTGGATCGAAGAGCGGTGTGGTCAACATTTACGACAACGCCGGTCTGA
CTGCCAAGCCAAAGCCGCGCAAGGCGCTGATGCACCTTACCACTCAGGTCGATCACCTCAAGTTCAACTCGAACTCGGAGATCTTGGCAATGGCTTCCAC
GGACACCAAGGACTCGTTGAAGATGGTGCACATGCCGTCGTTAACGGTTTTTGCCAACTGGCCGACGGCACACACGCCGCTGCACTACGTGTCGGCGATG
GACTTTAGTCCGAACAGCGGCTACTTCGCAGTTGGAAATGCTCGAGGAcgtgtgctgctgtatcGACTGACTCACTACAAGTCCACATAAAGAGGGAACT
CACGTCAAACACAAGCGCGCCACGGTTCTccaaattgctgctgttgggACGTTTCTAGGACAGAGGCTTGCTATATAATAGAGATCGACTGCTCGTTGCA
TACTTCGTTATACTCTTCTCATTTGGCCAGATCCTTGAGCCGGGTGATTGTACGTCAggttgagcttcttggccgtGGTAATGAGCGAGTCCAGCGCTTT
GTCAACTCCTTGCtcagctccatctgctcaCATTTCAATAGAAGCTAAATTGTCAGACGAAACGCGTGTGTGGATGCAACACACGAAACTCAGTGTTGAA
ATACGTACAAGCACGTTTATCCCAAGTGCTTGCGACTTGATGGCTCAACTGTGTAAGAGCATCAACTACACCTTGAGAGCCTGCAGTGAAGCACTTCTCG
TCAGATACAATAAGTCCTACAAAGAATTTAAGCGAACAGTACCTTTGTGTTTCGAAATCCCATTGGTATTACGGCGACTTGGTGATGTTGGCGAATCTTT
TCGCGACGGAAGTGGACGTCGTGGgcgttgtcgttgctgttgatgaCAGTGAAAAGCATAATCGAGTGAGAAGGCCTGCATCATGGATTTAAATGTGCCA
CTGTTTCGACTTACCAAGTAAGCTTGAGTTGGCTGTTGAGAGCGTGAAGGAAAGAGCTCCGAGTCATCGTGCGATGTCAGTGGATGCTCTAGCTGGTAAC
GGAGAGCGTTGGCAGCCATTCGAGTGTTCATAGCAGGCTGGTCCTGCGGTACAAGAACCGTCAAGAGTTGAGATTTGCAAACACTCCCTTCTATCTTGAA
AGCCATGCCGTAAAAAAATATTTACTTACTTTTGAGTTTGCTGCcagcgagcgcgagatcATACAAGCTGGAACGGCTGGAAGCTGATCAACTCCATTAG
AATATTGCTCACAAACATAATTATTTGCGGGCATGTTGAAAAGTTTCACCTCATTTGACGACCCAGCACCCATCAGAACATCTTCTATGCCAACACCCGT
CAAGAAGGTAGAGTCATTGGGATTGAATTTCAGCTCTGCAAAACGGCTCAGAAAGGTTAGAAATAATGAGGCTTAGTTCTTTGGTATTGCGGTACGTACG
TCTCCCCATAGGTGTTGCAGGAGTATCAGACTAAATAAACAAGCAAGCAAGTCCAATTAGTGTTAGTTAAACATCAGTCCACTAACACAATGAAAACCAA
GGCATCGTACCGGTCTCTTTGATAGTAACTCTTGATCAGTTATGGTATCTGGATTAGCCGACAGCAAAAATTCAGTCGCTCGAGTGCGAAACGGGGACTG
GAGCACCACCTCGTTTGGAATCATTTTGTAAATCTCAACGCTTTCGTAACAGGACATGGAGTgcagtttcttcttctttgtcCCTGGGTACGCGACCATT
ATAGTCATCGCAATTTGGTCCGCTGTTCGTTCGTTCAAGATGGCCGTGAGGCTTGGCACAGGATCATAAGCCAACTTGGTGGGGTCGTACGAGGTGATAG
CGGCGTGTGCCAGAGGATTGCCATACAGGATCAGCTTACGCAAGCTGCGTAGTTCACCTGTGTAGACAACAGACTCTTCGTCGGTGATCTTGTTGTGCGC
AAGATTGAGGTAAATGAGATTGTAGAACCCAGCACCACGCTTTTCCTCTAAGGTCAGTGCAGACTATCGTCGATGTGGTAGACAAAGACTACTAAGTCAG
ACCAAAACCAGCACTCTTCAAACAACTTTGTAACGTACCTCGGGGAAACCGGTGATCTTGTTGTAGCTTAGATTCAAGTTCCGCAGGCGAGGCATGATGG
CGAGGAAGGAGAAAACTTCCTGTCCGGAGAGGTTGTTGCTTTCCAGAGATAATGTCTCTAGTCGTGAGAATCGATCCATGATCGGTGGTAAGGATCGAAT
CCGATTGCTTCCGAGGTAAAGCTCACGGATACGCAGCAGATTTGACAATTCCTTGACGTCTTTAGATCCAAGGCAGTTGAAGGACAAATTCAGCACCTAT
CGAAGATGTTTGGCCAAGACAATATGAAACAGCAGAAAAAGTTAGCCGAGTGGAGCAAACAAAACTAGCTGCAGATCAAGTCAATCCTACCTCAAGGTTC
TGGAAACCGTTGCTTAGTGTGACCTCTTCCAGCGCATTGCACTGAAAATCCAACTCGATGAGGGCAGGTAAGCATCCAAACGGGTCCAACTGTGCCTGGG
TTCCAAACCAAACAAGAAGTGATGATTAATGTTGCACATTCGTGTTTTGCGAGTCTTTCAAAGCGAGGTTTTAGCGTGCACGCGAACCTCATTGTCGCTC
ATGTCGAGCCGTGCCAAGTTAGTAAAAAAGAGCAGGTCCTCAACCACGACATCGGTGATAAGCATGTCGCTCAGGACTGCCTGGACGACTTCATCAGGAA
ATTCCACTAAACAGTGCAAACAAGGCAAGCAAGTTGGCAAGGAAGTTTAACTAATTAACAGAACCGCAACCAACCTCGACACAAGTCCAAGAGCAGGAAG
CCGTCCAGCGTCCGGGGCGAATCATTAGAGATTGCACGCTTCCTAGTCGATCTGCGTGGCTCCTGATTGCTGCTATTGCTCAATACTGACGGAGGTGCCG
ACACAGCGGGAGAATGAACATTGCCTCTGGCAACAGTGTGTCCTAATTGCACCAGTGTTGCGTTAGCTGCTGGCTTCTTCAAAGCCTTGTCGATCTTCCG
ACGACGCGCGGAGTTGGCAACTGGAACAGGCGGCCGAGTGTCGTGTTCCGTCGGGGAAATCATCTCACGAAAAAGAGCACGAAGACCTTTGTGGGCGCCC
GACAGCAGAGGGCAGTAGGCAATGGAGTCGTCAGTCCACACGTAATGGCAGTTTTGGCCCTCATCCTAAAATTAAGTGGTCCATCACTTACTCGCCAAGT
ACCAACTCCAGACCgaccacctgcagcacgttTACATCCACAAAAGACTCGGCAGAAGTCACGACTTCCTTGGATTAAAAAAATGAATTTCACCTTGTTC
TTAGTTACACGCAAAAATGTGTCGTGTCGTATCCGATACAGGGCGATCTGTGCCAGCCGACcagccagctccttctgccgTATTCCCTGCAGCCTTGAAA
TACCCACGATCATCGATCGGACTACATGTGCGAGGAGAAAGAGGCGAAGCTGAAAGCTGAAGCTGTCCGCTCGCTTCCGCACCTCGTTAATCTAAGTAAA
CTTGGAAATGACTTGCCAGATGATCACCACAATGAGACCCAAGATGACGATGTACAGGAACAGAATCTGCGACGCCATCTtgcacttgagcttcttcaga
TGCATCCCGGCCTCTGCTGTGTCCTCGCGCGTTTCATCAACCTGCACCAATAACaaacaacaaacaaaaaGAAAACATTAGCACCAAGAGGAATAACCAG
CTTCAGTTCTGCTCTATACATCGGCGAACGTACGTTCGTGCGGACGTTGATGAGCTGTTCGCGCTGGTCCGCGAGGTTGACGTTGATGTTTTGGGCCGTA
GCCTCCGTCCGCGCGATGATTTCCTGGGCGTCCGTCAGGTGGTCGTCGATGCGGTCTGTGCGCTGCTGGTAGCGCGCCACGTTGTCCTGCGGGGCGCGGG
CCTGTTGACGCTGTTGGCTGCCTTCCATGAGCTTGGAGCGCTCGAGGTTGgccttgagcttgtccagctgCGACTTGAAGgtgcgcagctgctggtgcat
cCGTCGACGGTCCTGCGAGTCGCCGGCGCGCGACTCGCTCTCCAGGATGCGCATGTAGCGCTCGGCCTCCGAGATGTTGCCCTGCGCGCGCTCCGACAGG
TCGGTGCGCTCGCGCTGGTCGCGCGCCTTGGGGATGGCGCGGATGTCGGACATGGCGTCATCGCGGCACTGCTCGAAGTCCTCGCTGTAGCCTATAAAAG
CCTCCGTCATGGTTGCTGGTCGCTCGCTAGGAAGGAAGGAATCAAAGGAAGTCTCTGTGTTGCACTTCTTTTAGCCGAGTTGATGTCAGCGTCTTTTGTC
CGATACAAAAAGGAAGTCAGTTACAACCCAACAATCCGCTCCAGGGGATCTGCGACACACATCATGTTTACACAAGTTAGCCTCTCCCTCTGGTACAGTG
TCTTCTCGAGTTTTCCACAAACACCTAGTAATTTATTTCGTCCAACCTAATAAATTTCCTTCACCACGGTAATCTATTATCGATCGCGGATGTTGCCCGA
AGGTTGGCATTGACGTGACGCCTCACCCGATGGTGCACCAGCAAAGCAAACGCACGAGATGCGTCGTGGCGGGCTCGATGGAAAACTTTGTGCGGACCCA
CACAGTTATCATCCGCAGGGCTGTATGTTttcagcaagaacaagacCTTCAACGAGCTCACTACAGTAAAACTtttttgaatttgaatttgttgcGGTTT
GGTTGGCTAACTACTCTTACATTTTGCTGACAAGTTATTCCTTCTGGATTCTGTCTAACGTGacagagcagagcagcaaacgtCCAATGCCGCGCGCCAT
CCAGCTGTCGAtgtcaccaccagcttcaaaCTTAGCTATTAGTACACTTCCACCAGCAGCCGACCagatctacatgtatcttcTGGACTGCCAACAAGAT
TGGTTCACCAGTCTTTCTCGAATGATTTCCAACATCCCCATAAAGCAAACACGAGTCAACACGGTTGAAGAAAAATTGAAACTATTGGTAAAGAAACTAG
TGACCGTGCACTTCGTACACGGTCACTACCACCTCATTGCAACTTCCGACTGAAAGCTGCACAACACAATTTGAACATTCAGCTACACCCTGGCGTCGAC
ACGAACGAAATCTCATCTGCCTTGGCGCTCAACTTGCAGCTAATCGCTCAGCCAAACAGCTTAGTCCAGGCCGATCACATTctccagcaggaacaccatg
aagatggagagcgGGTACAGGCACAGCACGATCAGACCGTCGAGCAGACGCtgggtcttcttcatggcaATGTAGCCGAtcacgagctccacgaacAGGA
TCGAGAACGTCTCAGCAGAGAACTCCCACACCAGACCGCCACTCTTGAACGACATGAGCGCCGCAAAGATGCCCAGACAGAACGTGTTGTTCatgcaagc
agcaccaagaagagcagacACTGAAATGGATATCGTCTTGGAAGTTTTCTTCTGCGCGTAGTTGTACGCAGCAATGAGCTCGCTGGCGTTCGAAGCCAGC
GGCGCCACCACGAACGACACGTAGAACGCGGGGATGCCCGTGCGAGCACCAACCTCTGACAACACATCGACCATCGGGtccgagaacagcagcacgagag
cCGTGCCCAGGAACATCATGTACGCAGAGCGGATTTTGATCTTTTTCTGCTGATCGGCGATCGACAGGTGAGCGAGGTCCTCCGggacttcttcctcctc
ttcgtcgtcctcgcctTCTGCGGCCGGAATGGCCAGTgagtactgctgctccaccaccacgcgcttCATCGAGACGGACGAATGGCCCTGGATCTCATTc
tcgtacttggccagcagGTAGCGGAGAGTGGCCTCCACGAGCTCATTGAACTCGATGAATCCGctcttgtccttgtcggcGGCAGACATCCACGTCTCCG
CCTCGTCGCGGGAAAGGTTCTCCCCCAAGTCCTTaaagaagagctggagctcatcggCATCCATGCGGTGGTCACGGTTCTTGTCATAGGCATGGAAGAA
CGGGCGGATGATGTCGGCGACGCGgtcgaactgctcgcgcGTGGCGTTAAGCGGCGTTGTGTTGGTCGGtgtctccttcttcaggttgGCCACCTCCTTT
GCAAGGATACCGGACAGACTGATCTCTCCGTCACGGATGGCAGCCACACGGACCTCGTCAATGACGTCGTCCTTGACCTCCGAGGAGCGCTGCACGTTCC
AGTAGAGGTACAGCACAAAGGAGACCATGGACACCACAAAGGCGACAATGGCGAAGGGCTTCTCGGCCTTGGCCACCTGCGTGTTGTCggccttggcgtc
ctccGCGGCCGTGCCCGTGTAGAAGAGCGCCGGCACCTGCAGGATCAAATAGATCATGCCCGTGAAGATCATGGTCTTGGCCGTGGACGGGATCTCGTCG
AAGAGCACGACGCCCGTCTTGGTCAGGTCCTTGTTTCCCGGCGGCATGAGCTTGGCCCAGTGCTGGTCGCCCTTGGGGCGCACGTAGTTGCCACGGCcgt
tctcgtcgatgttgACGCGGCCGGCGTAGATGCTGAGCGCCCACGGGATGGTGAGCAGCATGATGGTGGAACCCGCGAGGGCGCCCACACCCACGGAGAC
CTGCTCCTGGGCATTTGGCCCCATGCCGGAGAACAGCACGATGGCGCCGTCGGGCACAGCGCCCAGCACCGGCAGCACGACGCTGCCCACGATGCCAGCC
ATGGAcggcacgagcagcagcaactcgctgccGTCCGAGATGAGGTTGCTCGCGTTGAAGAGCACGAAGCCGTAGACGGCGCCCAGGAACAGCACCTGGA
TGAGGCCGTAGCCGCCGTCCGGCAGGTCCTTGGGGTCGATGAAGATGCCCGACATTGGCGTCTAACTGGACTGGAGTTGGATCGGGTCCCTGGCTGGAAG
TCGCTTGTCACGTCCGCGTGCTTTTGCCAAGTGAGATGAGGGAGCCAATAAATGGATCGCGGATCTTTGACAGCACCCTGTTTTTACCGATTGCTCGAAT
GATTTCGCGGCGGTTCGTGTCGATTAAGGCCCCGTTTTGTGGAGCGCCCTACCCCTTACTGCATAAATCGAGGTATCCTTGAAGTGGCCTGAGTTGTGAC
GTAAGCTCAATGAGAGTTTCTAGCTGCTCGGAAGTAGCTGCAGTCCTccatgctgctgaaggaaggACACCCACAATTGGAGGCTCGTGTACAAAGTTTG
ATATCGTACGGCTTGAATTGACGCTCTGCTGGCATGGTGTCCTCGTCATCCGTCATAACGACTGGAAGGGAGGACCCTCACCCCATGATTCACCGTTTCT
GCGCGGTCTCATTTCGAGTTGGATTTTCCGCTCAGCCGGCCATTTGATGGGCAAGCatgcaggcggcggcggtgtCTGCGTCTTCAGAGCGTGACGCGCT
GCACCGTGAAATTTGCCTGCACCAGTTCACGGTAGGCATGCCGAGCGATGCCGGGCTGTTCGTTCATCCGTCATTTGATGCCAGATCAATCCAGAGCTGG
TCTTCATGATGTGTGCTGATTTCAAACACAATATGtgcttgaagcgctcgatGAAATGCAGCCCAATTTAACAAACTCCTTCCAAGGAAGAAACACGTCA
TAAAGTTGGTGGCGTCCAAACCACTGCAACGCCTGCAGAGGCTCACCGCCAGAGAGCGGAAATCTGCTGCTGATTACTCAGAAAGCTGGCTGTCTCATCC
CAAGCGTCGTGTTGCTCAGCTGCAGACCAGCATGCTGTCAATCAAAGTTCGCTTCAAACGGGTTGTCTGGGGGCAATTGGTTAAGCGAGAAAGGATATCG
GTGGCTTGATCTCAGTTGTGAATATTCCTCCATCGTCGCCGTCTTATTGCTGGTTATATTCGAGCTTGCCAAGGTGGGTCGCCTCACATAATGTCATATT
ATGATGTCCCTGAACTCGTATCCAGCCTGATTTCCAGGCCTGttctctacatgtagtatctTAGCTGCCTGCTccgtcaactgctgcagcagagcgcaGA
CCAGTGCCGCTCGGCGAGATCTAATTCAACAGCAAAGCTGGGGTCTACAGGGTACCTGTAGTAATGCGTTCACAAACTGGTCATAAGCTTACTCAAGTAG
AGAGCCAAGGCTCGGGCATCGGTCTCCTaaaactccagcaccagaagCCAGTCGTCACCAGTGCTGCCGATCGAAGGAGGAGTGAAGTCCACGCGCGTGC
CATTGCCGCTACCAGGGACGCTCACCGTGGAGCTCGCGTAGTACTGACCGTCACGAGGACAGAACCAAGTAGTGCTGCCCGAACGACTGCCCGATCCGTT
GTCCGGCTGCAGGCAGAACGAGTCACCGTGACCAGTGTACACGTAATAGCGGTCACAGGTCTTCGACGCCAGTACCGAGATGTATTTGGTGCCCTCGTAC
GTGTTGACCGACGCACCTGTGTGATTGCTTGGACTCGAGAGAAGCTCGCGAGCTGGCTCGAGTTGCTCAAGCGTAGCAGTGGAGAGGCTCTGGAGTGGTT
TCATGACGTACTAGGCCTGCGTTGTGCCGTCAAAATACAGGTCTTTACGCCACGATCCTGACGCGTTTTGATTGATTTGTGGGTCGGTAGTAAACACTGT
CACTGACCAGGTCGGCTCTCGGCTCGTACAATTGCCACACGCTGTTGGCGCCGTAGGTGAAGCCGATGGCTCCGTTGTAGACTCCGTGATAGAGTCCCGT
ACGGATGTAGGACGCGGACGTTCAAGGttaaagttgaagtgcgcaCCCTCGTAGTGGTTTTCGAGATCTAGGACGGGGCCTGTGAACTTGTCGCGCATCT
CTACGATATTCTCGTAGTTCTTCGTCGAGTCCCAGCCGCCTAGGGGCGTGAAGTTGTAGGTCGGGTCTGGCACCGCGTGGTCAGACTGCACGGCATCACC
CGACACGCGGTCTTCCTCGTTCGGCATCACCTCCGGCTTGACGACCCAGCTATTCGTGGGGTGAAAAAGGATCAGACCGCATTGTCGCCCACCCCACACC
GCCGATGTGTCCTCGATAGGTGCCATCATGCTGATAAAGTCTTGGTCCGGGTTTTCGTTGTATGCGGCATGGACCAAAGACATGTTCCACGACCAAAGAG
CGTTCGAGTCACCTCCGAGGACCTTCGGCAGTCCAGGTAGCGCGTCCCGATGAACTTGCCCCACTCGTAAGCATTCGATTCGTTGATGAAGGGAGTTTTG
CTGTCCTAGCCACCCTTGACGTACATGCCCCACATCGGTACAATCGTCATCAGAAGTCCGTAGCTAGCAGCTAGATCCGCAGCCCAGTCCACAAGCTCGA
CGTACGCTTCGTTCCGGTGCGCGGGGTCCATGTTGCTGAGCGGCAAATCGCTGTAAAAATTGGTTCGTGTCACGCCTTTCACACAGCCGACAACGAAAGT
TTGAATGACGCTGTAACCTTGTTCAGCCCGTGTGCGCAGATAGAAGTCGATCGAGGTCTTGTTGAGACGATGAAAGAGCTCCCACGCCGTGTCAGCTTAC
CAAAAGAAAAGTTCTTCGGAGGCAGTGCGGAAGAGGTACCGTCCGTATTGCGGCGCGGGTCGTGCCAGGATGGGTCTGCCGAGGTAGTCGTGGCAATATT
TCCCAGGGAGACGAAACTGGCGAGTGCAGCTTGAATCTTCGTAGGTGTTGCAAGTAACTTGAACGCTTGGGCTGGGTTGCTGAGGTCAATTCAAATTGCA
GATTGAAACGAAAGTGTTTGCTCGCACTTCATAATTTTGGTCTTTGTTGGTCTGGTGGAGAGACTCTCACCGTGAGAGTACCTCAATACTAAGATAAGTC
TGGCACTCGACTTGATACCTTTTACGGTCACGAAATGCGTACTGCCTTATGCCATGCTCGGCACTAATCATAAGCAAAATTTACAGACATACTGCAACTT
GTACACGTTCAATGTTATTGGTTCCAGCTCGAGATCGATAACGCCAATCCAGATGTCACCTTGAAGTGTCAAGGAAGAGCATCGCTCTAGTTGTGCAAAA
AGTTTGCAGCACTGCAAATGGCCTTAGGTACCTGAGCCCTGACTAAGCGCCTGAGACTCTCAGGCTGAGAGGACTCCACTATGCGGTAtgcatgtgctgc
tgttgtccaGTACTGTCAGAGCGTAGCCACAATCACATTGCGCATACACAACAATGGTTAGCAACATAGCTTGTTGTCACTCGTTTCTGTGAAGCCGAAG
CGCTCAAAGAGAAGATTAATGAGATCTTGCGTTTTCAGTCTTTCCTGCACCCAACGGTCTTTCATgacttcagcagcacaagttACTCCTTCAGTTTTCT
TCACCTCTTTGGTCACTTGATGGAGGAAAAATCAATGAGCCATACCATCACTGTCGATTAACGGCGCATGCGATTCTTCTACTCGTTAATAAGGCATTTT
ACAGCCCGAACTTCATACAGCCACTCTCCTTATGCTGATCTCCACACCCCACACTGCAGTACCTCGACCCACATCTCCGACAATTGTAGTTTGCAAAGAA
CCCACACACGCAACAAAACCTCCGTGCCGGATGTGTCGGAGGCCCCGCCGCTGCCGTCAAGTAGTTCGGCCCCTCTGCGTTGTCCCCATTGCCCAGTTCT
TCAAACACCAACTGGGCTAAACTCTTGaccttccacttcttcttgcccgaCGCAGCCACtctccgcttcttcctgATGGATTCTCTGCCCCCTGAAGTGG
CAGTAGCTCCACcttcctcctcatccacGTAcgcttcgtctccatcttgtgttccgtcgccttcgtctgcatcttcacCGAAATTATCCGCTTCCAGGGC
ATCCAGTCGAGCATTACGCACTTCATTTCGTGTGTCGTCATCCACACGTCTCATAGCAGCGCTCAGCTTGTGCGTTCGCCCTGTATTAACCGTTCAAAAT
GCATTATCAATAACAATTACAATCATCAACTCTTTTTTTTTCACATCTATTATGCGGTCGCTAGTGAACGCTAGAAGCTCGGAATAGCGAGGAAAGCAGC
GGCGTCGTACCTGAGAGACGCTTCTTCGCAGCGTTGTGTCGCGCGCTGGCCGCGGAGACCCGCACTGTCGTCGCCAGGATGGTCTCATTCCACCGCTTTT
TGCCGTCGTACGCTTTGCCCATTTTCGCTTGTGGCAAAAAATATTTTGCGAAATGAAggcatacaaaaaccaagatAAATGTTGTCGTCAAAAACAAATT
TGTTTTTGCTCTATTGGACTCGGCACTCACTACCATCAAAGCGTATCCTACGTTGGTACTTTTTTtcgatcttctccttgcAAATTCCTCATGTTTGTCT
TGTTGTCATCTCATTTttacgacgagatggagatggctCCGCCCATAGGTCGTTGCTCGTCAACTGTGCTCGATCGACCAGTGGCCACTGAAGACATCGA
CCCTCTGCCGATACTCTCGGTCTTGAATTCAGCCTCGTCGACCAGGCTGTCCAAGCCGTGCGTACTGTTTTCGAGATCACTCGAAAGTTTGTCAAAGAAC
GAAAACGAACTCTTCCGGAAATGCATCGACTTGCCGCTTCGGTTGCTGGTATGGTCACCGAATCGAGACGAGTCGCTTGAACTTTCACTCATGCGGGCAG
GGCTACGCGGAATACTTCCAGCGATACTGCTCGCGTCACTTGCCTTCCGATGCATGTACTGGAGAACGTTCGCACGCTCTCGCATCGCTTGAGAACAATC
GTTGGTGCGCTTGGGGTTGCGCATACGCTTTTCCTGAGTATAGGTCTCGTCAACAGGAACTGACACGATTCGACGTATCTGAGGTGGAGCGCACCCACCA
GCCTCTCCAGCCGCAATGTCCATTGAGCTAGATCGACAGTGGACCGGGGAGTATAGAAGCTCATGGGCCGGTGGTATCTCCTGTTGTGTCAACGTAGTCT
GCCCTTGCGtcgcgttcttctcgtcgagTGAATGGTTCGAGTTCGTTTCATCTTGCGCCTCATCTTGTGGATCCAGGGTGAAAGAGGCTGTGTTCACGTA
TGAGTTGGTGCTCCTCGACAACGTGCTTTGGTCACTAAACCCACGAGAAGGGCGTCCACTTCCACTCCGAGCAAGTTTTCGTACTTCATCGAAATCTGGC
TTTTGCAAAACTCCGTCAACGTCACGTTTGAACGGATGTTGTGGCAGCATTGGTCCTTGTTCAGCATCCCGGCGTGCCTTTTCAATCGTGTTTTGACGTT
GATGCTGTCCTGCAATGCCCGCGGGGGATCGGAATGGGTCCGAATACGAGCGCGATAGAGACGGTTCTTCCAGCATTGGGATGTTTTCGGTAGGTGGGCG
CTGATGTTCATTAGATCTCCTTCGGTGGCCCAGCGAAAAACCTTCAATTTCTTGAGATTTCTTCGGCTGGGGGCAAAGCGGCATCGGCGATGAGTCCATA
GCACCGCGCAGCCATGGAGTACCTGAGTCAGCTTGCCCATTTCTCGTTGCAGGGAACATGCTTTCAGAGCGCTGGTTGCGCCGAAGGCGTTTCTTCtccg
ctttcttcttctccttctgaGTTTTCATGTCCTTGTGCCATTCCTCGAAGCGCTGAATCCACGCCAACGGTGAGCGCCCAATCAACTGGGCATCCTCATC
GTTGTCTTTTACCGATCGGTTGTTTGGGGTGCTATTTGCACTGTTGTTTTGAATCTTCCTAGTGTGTATGAGAGCTGAGCTCTTGCTTCGGCGGTCGCGT
GTCAGTCCAGACCCACGTTCACCTGCATCCGACCCGTTGGGACTTGTGTGGTGACCTACCAAGTTTGTGTCAGACTTCATGCGGCGACCTTCCTTTTCCT
GCGTGCTGCTAACGGCAAAACCATCCGTTGAAATTCGACGAACATTTCGAGCGCCCCACTGACGATAACTATCTGCAGAGCCCCAATACTCATCCTTAAT
CTGCACAGAACATACAACCTCGTAAGATTCTGTCTTCCTTGTTGCTCAACACAAACAGCATAGCACTTACTTGGGGTTGCATTCCTTCGTAATACTCGGC
GAGGTTGGGGTGGTCTCGCCGAATGGACTCCATGTACTCATCAGTGAGATGTCGATCAAAAGTTCTGAATAGAAATACAAAACGCCGATACGTTAGCTCa
tctctacatgtaccttaTACAAGTTTCCGATTGAATTCACACATACCGTGCTAATCGAGGGGGAATCTTGTCCATGGGTCGAAAAATGCCTTGCTTCTTT
CGGCCAAATATTCTCAGTCGTGGCTCTGACCTGCACTCCGAGCTTCGCCGCCCTGTTGTTGAGCTTCGCGCATCATCTGCTTCAACGGTGGAGGCGACGA
TGCCCGATGCCAATTGCAGGCGGTGGTGGGCTCGAAAATCTTCGATTCGGCCGCGAATCACGCAGTCCTGCTTTTTGGAGATTTTCATCAATTCCAAAGC
ATCAATTTCACCTCTACCAAGCTGCACGCATAACATACCACAGACCGGAGCAACGTCAGTAAGACCCTAATAAGCGAATTGCAGAACACGTTACGCATAC
CGGTACCTCATTCAGATGTTTCAGCATGTCTCCATACGTATTGCACGCGATTAGTTCCAactttgcttgctgcagcagtgccaaTGCCACCCTAAAGAGA
ACCTACGCAATCACAATCACAATCACACTCACAGTTAGACGTTCACTGGTATACAGCCCACTCACTCGAATGCAGCAATGAGTTTACCTCATCACCTTGA
AGGAAAATAGCATCCCAGATCTGGAAGGTGACTTCTCTATCGCATGGACTAGCGAAGAGGGTCAAAAACCACTCTGTGCATGCAAGCGAGAGCTCCATCC
CCGAACCTCCTAGCTCCGATAGGTGCTCGGAAACCTCCGGGTACTGAAGACGCACGAGGTCTGCAAATACGTGTTGGTCCACAGCCAGTCCCAACTACAA
TTAAAAACGAGTTAGCGAAGAAAAAAACCAAGGTTACTTTCAATGTGCAATAGGCCACTCACCATTGTCGTGTAGTAGTCATCGGGAACAAGCCGAACAA
TCGCAATGAGCAAATAAaaagcttcttcttcgtccagaTATTGCAGGGTTCGAGCGACAATATAATTCAGGCCCTGACAATACCCCAGACTGGGGTTGTA
GAATGAGTACGCGACTAAAACCCGGCGCATGATCCTTGACTTCTCCTCGGTCCACAGCTCTTTGTCCTCATCAGCAACAGTTCGGTGGAGATCCACATCA
ATCTGCCGCGTAGCCTCGGTGCTCTCTAATTCCGAGGCTAATAATCGCTCGTACTGACCCTTGTTTTTTCGCATTTCCAGTTGGGCGCCTGACGCGAGCA
TCCATAGCTTTCCATGTAGATCGCCCGGCACTGCCCCAAAATCGTGATCATCGCGAATTAGTATTGCTCGAATACGCTCTTCCGTGCGCCAAATGCCGTG
CGCGAGCGGACCCAGCCCATCAGGCACTGAGGAATCGCCAGCGCGATCTCTTTCCTCTTtccgctgttgctggtgctcatATTCAAACAGTAATCGCTGC
CACCGCGATTGCTGAAGCATGTGGACAGCTTCAGGAGACTCCAAGTCCAGGTCATCCGCATCgagatcgtcgtcgtcgtcgaagacgcCATGCTCCGACA
TCGGGGACCAGTCCTACAGTAGTTCATTCGTCGTGAACAACCCCACATCACATTGTGAGTGCCAGAAATACGATAATGGCCATGCTAAGTCACTACAGTA
CAAGCACAAGCATACACAAAACAAATAAAAAAAGACGCGGATGCCTACCGGTCGGTTGATCATAGAGCTTCGTTCATCAATCGAGCGGCGGTTCGACAGC
GACACCGCCACAGTCTGCAACGCGAGGATATTGCTGTACACTGCCACGCGCAAACCCAGCAAGTCAGCACCGTAGAACTACCATCCCAATTAATGACCAC
GAACGTCCACACACCTTTCTCCATAtccttgcgcttgagcagATCATCCGGCTGGAAGAGATCCCGACGCGCGACTCCAAGCACTTCACAGGCTCTAGTC
ATTTTGGAAATGACGCCGCAGTGCCACAGCGAGAGAAATGAAGCCAACAACCAGCAAACATCaagaacaacagcagcaacatcgttAGCGCCCGCACACG
ACCATCAATTCAGCCACCGGCCGACGACTAGACAACGATCGGCTCCATTCGCCACCCTCACTTGCCATCTCCCCTCCCCACGAAACTATTATAAGTTAGG
GACAGCAAACCCACTCCAAACGCACCTAAGATACTCGAGCACATTGCTCAATGCGTCCACGTCGCATCCGCTCGCCCTGTCGCCGCCCTCAACACGCACT
TGGCTGCTACCTGCAGTGGCCCGCACTGGGCTGATCTGACTCTTCATGCCCAGTGCCTTGTACAGTTTATTGACCAGGTCGCACAGCAACTCGCCCGAGT
GCAGCGCCGCCGGGAGGTCGCGCAGAAACTTGTCGCCCAGTACCATCTCCATCCAGCGCCGCACGATCTCGCCGTCCTTGCTCGCGTTGCGCGTGGGCGA
CAGCATCACGCCCGTTGCCAgttcgtcctccagctccatcctGCCTGCGGTCGGTCAGGGAGTTCCTCTATTATACTAGTTGCCGAAACGACACCGAGAG
GCGCAAACTGGCGCTCCAGGAGCATGCAAGTGGCCTTCCTACCACTGGAGGGGAGGGAGTTTGCCTGCCTGCTGCTCAGCACGTCACTCGCTCGCTGGGC
TttgcgctcgctgctctgTCTGCAAGGGAAGCGCCTCGCTTCGCTTGACTCTCGACTTGACCCGCTGGCTGAACTGAATACAACTGCCGAAACTGGGTGT
GCAACCCAATCACCAGTACTCCATTTTGTCCTTAAATCGAGGGCAACTGTGCCACAATAGGGCATTCTGAGACAATGTTCTTATCTTAAAGATTTGTATA
TTTCGCGCAAGAAAACCCGTTGCACTGTCGCTGACACCCTGTTCAAGTCGATACCCATTTGACGAAATCTGTAGCAATTGTTCAATTGAGCCGTTGCCTG
TTTGCATGAAAATTTATGTTGCAACCCCCTGAAGCCTGACGGCTCCGTGATACTGATGGCATCAGTATCACGGAGCTATCATCACTGATGGTCCATCAGT
CAGATGATATTGCTGGTACGACTAACCTAACAGCCGTGAGAGTACtaactacttcgaagtacttcagagtacagtaatctgcgtgagtaccaaacgcctg
atatatataagggctccaggtgtatagAATGATGATGAGTGGAGCACAGAAACGTCTATATTGAATTAGTTTAATTGAGCAAGACTACCCGTCACTACCC
TGTGATGACCTAGATTTGGTCGGGCGTGAGCGCGGTCTTGTCGAGGATGCCNGCAGAGggtgaagaacgccaaaagcgcgccatttttcaaatgGGTTGT
TGAACATAAAACAAATCCAGTCGAGGTCTGATGGATTTTTATATCAGTACATTtgcccatctccgtctcgtcgcgttgttgcacctgaCCTATAAAATAT
GCGAGGTTATAAGTTATATATCcgttcggtattcacgcagattactgtacttAAGTGTGCAACATTTTGAATTGGAGCTGCCAAATCAGGATTGAAGCAC
CCATTTCGTAGTCGATGCAACCATGCTGCTGAGTGGTCAACTcggccagcaccttggcaTTTTAAGTCGATAAATATACAGAAACATCGACTTCCCAGGC
ACGGCGGTCGTACCTTGCTTTAGTTCCCAATTGCAAAGGTAGCGAAAACAAAGCTTTTGAGGGTACTATTAGAGTACCGTAGTTGTCAACCTGTTGCAAC
CAAAACCTTCCTAactattacatgtagtattcGTACACACTTTAACGCTGACCATGAAGTTTCCATTAGGCTATCGCCCTTCGGATCGGTTCATGAAGCC
GAAACATTTTCTTTAAAGTGCAGGCATCGGATCCGGCCAAAGTCATCGACGCGAAGTACCGAGGCACGGAGACGTGCGAAATACCGCGGAACGTTGCCCT
GAGCTTGTTGAATCACCCTGAAACGAAATCACTGTGTCTGTACTTCAATGCAACACTGCTGGGCTGCCTTACATGTACTCTTCGGTGCTCAAACAGAATT
TGTAGACATCACACGAAGTTGATGCTGGCTACGACGCATTTTGTCAAAAGCACACTTCCGTCACAGCAACTTTTCGCGCCTAAAGTAAAATGTCTAAATA
TCATCAAATTCAAACTCACTCGCTCCTACTATCCACCCACCCTCTAAATATCAACTTCCCCCTCTTTAAGTCGTCCTCCGACAACATTCTCTCTCCTCCG
CAACTGAAGCACACGCCAATCAAGCAACGCAAGCCATGAccagcaaggacgacgctgcagcttcaacttcaccgGCCCAAGAGCACGTAGACCCCCCGAT
CgacgccaacaccaacgccgacgccgacgttGCCCCCTCCAGTCCGAGCCTCTCCTCCACCACAGGTGTGCGCCCTCTCCAATCCGATGCCGCCCCAGGC
GAGGAGCCGCTGGTCAAAAAGCGCCGCACCAAGAACTTCCAGCTGCGCGAGGACCTGGCCAAGTCCCGCGGCTCCGTGACGGTCCACGTGCCCGCGTTCG
CGCCGCTGACGTTCGACACGTGGGACGAGTTCATCCAGGCCTGGAACGGCTACATGGCGCGCACCAAGACCATGTACCGGCgccgcagctcgtccaccac
cacgtaCTGGAACAACAAGCAcaagttcaagaagtacCCGGTGCCCGAGGACTTCAAGTACGCCACGATGGCCTATTGGTGCACGCACGGGTGCATCCAG
CCGTCACGGGGAAACGGGGTCCGGACGCACCTGCACAACCGATACACGGGCTGCTCGGCGAGGATCACGGCCGACGTGGTGTTCGAAATGGTGGAGGGCG
ACCCCAGCAAAGTCCGCTGGCTGGTTCGCGTCCGCAAccaggtattaatacctaAGAAGAGGGGGGAGGCGGGAGAGTAAgctgactgactgactgactg
gtggtgctgtgtgTGTTTCAGATCTCGCAGCACAACCATCGCATCAGTGACGAGATCTACAACTGCTACACCAATAACAGCTCCGTGccggacgagctgc
tgttgggcCCAGATGCTGAGCATCATCATAAGCAGGAGCCACAGCACGGAGCGGGGGATTCAGGTACCTACGTTACAATGTTGGGGGTCTGTTGTTGAAG
TGTTGCTGACAAGTAGCTGTTTGTTTGTGCTGGCTGGATGCAGCGTATGAGCCGTCGACTCGCATTCTGACGGAGCTGGATCCTATGGGTGTCGATTCAG
GTGAGTGGATGCACTGCTGGTGCTTGtgtggtcgtccacgtcaatACTAATATTGTTGTTTCGTTGGCATTGATAGGATTCGCGTTGAGATCTACCCCGG
AGTCGAAGTTGAACGTTAAGACTACCGTGACCACCGCGGCATCCACAGGTGCGATACCGATATTGTCTACCGAAAGCCGGGTAAATTCGTTGCTAACTCG
ATTCTGGCGAATTTGGGGTAGCTGTTTctgagttgctgctgaaagaAGCGCTAGCGAACGGGCATAAAATGAATATGGCTGCCTCGGAGATGCAGCCGCT
GCTTGATGAGCTGAAGAATACCCCGTCGCGTGTGATTCACAAGAGGCTGCAGGATGTGTCGGAGATGGTCGCGCATTTGCAAGCGAAGTGGCACCAGGGT
ACGTTCAATCCACAACCACTACTCTGTACGCCTGCTTAGCTAACTCGTGTTTTACCGATCATCAGACCGTATTGcggaggaagctgcacaagcgCATGCC
GTTGCGCCCATTGCTTCTTTATCTGTTGAACAAGCCGCAGCTGCACCAAGCGAAGCGCTCAGCAAGGCAACCGCCAACACTATTTCTTCAATTGCGAGCT
TGCCTCCAGGCGCCGCTTACTACCTGACGCCACGTGTGGAGCAGATACCAACTGAAGTGAGTCGTGTGGCTTCAACATCTGCCAGTACCGACAGTCGATC
GGGCGATGAAGCTACACCCGCCCCAAGCGATCGGGACCTTCCAGAAAAGAACGGGCAGGTACTGGGGAACCAGCGTGGGCCTTCGGAAGCTGTATAAGCT
AGCGTCGCTATCTTGACGATGGCATAGTGAGTAAAAACGAGTTTGATTGCATTGGTTTGTCGTCTGCAACTCGGTACATTTAAGGATCATGACAGTTCAC
TGAATTCGCGCATTGCTGGTGGTATTTCGGTCGAGGAAGCAGACGGTTTTTCGGTTGAAGACACACACATTGGGCATTAGCATCGGACATGCGAAGCTGC
AATCCAGAATCTCACCATTATTTCCGTCATGAATAGACACAGCGATGACAGTGCACATTGTCCACCGAGGGTCATAACGCACGTTTTCGCGAGCGAACCC
TGCACAAAACACGACACCGAGTCAGTGCACGAGAACGAAGAGCTCATGTGTGACTACGAGAGGGATGGCGATAACCAGGATGATAGCGAGCTTTACCATC
CTGATGGTGATGGTGGAGACTTCAATGAGTTGGCAGCAGAAACATCGAGCCTTGCATCcagcgacaacagcagcttcgtaTGGAGTGAACAAGGCACAAT
TACAGCAGTACGCGTGCGACCCATGTTACcgttggagaagaagagcaactATCGCGTCATTGTTGGCATGAGCATGAATAACGACGGCTTGGTGACTAGA
ATCGTGAACCCGACAGCACTCCCGCCTCCGTCTCGGAGTCACGCGTCCGCAAGGTACACTGCACCGTTGATGGAATCGCCACCAGCTACAGATTCGGCAA
ACTTCCCAGCTCAGTTCACCCAGGAGTTCAGGTTTGACTACAGTTATTGGTCCTTTGATCATTCATCAGCGAACCAAGTAGCCACGCAAAGCACAATCTA
CGACGAACTCGGTGTTCTCGCCCTCCAGTCAGTGTTGCAGGGTCATAACTGCTCTGTTTTCGCGTACGGTCAACCGGGCGCAGGCAAGACGTATACCATA
ATGGGGGGCAGCGGGGAGCGCACATCTTTGGCTGCATCAGTACGAGCCAACAACAGTGGTGGTAATAATGTGAGAACTCCGAGTACGCTAGCAGCATCAG
AGCAACGAGGCTTGATTCCACGAATTTGCCAGGGTCTGTTTGCCGAGATCGATGAAGGGAAGAACTCTGGTTACGCATACGCACTTATCATGAGCTACGT
GGAAATCTACGATGAACGAGTCTACGACTTGCTCTCTCAAGCCTCTAGCAAGGTGAGTCATGCTCTTCAATCGCTCCCTGAATATTATTTACTTACGATC
GTCTCTTTTCATTCATGGTGCTTTACTCACTACAGCAATCTCTCAAGGTAAGGGAACACCCAGAAGACGGTGCTTTTGTTGAGCGAGCACAGCGCGTGCA
TGTTACGAGCTACACACAAATCTTGGACTTGATCGAAGAGGGAAATCGGTCGCGCTCTGTGACTTCCACACACAATAGTGGTCGCCCTACCCGTTCGCAC
ACCGTGCTAATTCTTTCGCTCACACAAAACACCCTGGCCGATTCCACATCGATGGCATCGACAACCAGAAGTTTCGAGACGCTAAGAAAGAACAAAATCT
GCCTAGTGGATTTGGCTGGCAGTGAGCGAGTGGACCACTCGGGGGGTAGTGGGTTACGTCTCCGCGAAGCTGCAAACGTCAATCGTTCCCTTGCTACTCT
CGCCGATGTGGTTAGTGCTCTTGCGAAGCGCAAATGCAATCGTTCGGTTGACGGCTCTCAACAGCAAAAAGCGTTTGTTCCCTACCGAAACTCGGTATTA
ACGAGGCTACTGAGAAAAGGCCTTGGTGGGCGGGCCAAGACTATCATGATCGGGGCCATCAGTCCGTGTTGTGCGCACTACGAGGAGTCAATTGCTACGT
TAAGATGCATCGAGCGTGCGAGGAGCGTGTACAGCATACCTCGGTTGCAAGTGGATACCAGTGGTGCCACAACACGGAGATTTTTGGACGGCGCAATCGC
GCTCAAATCGAACCTCTGCGCGTCAAACGAAGTCAAAATTCCACCAGCAATCGCTGATACGTGTTGTGGGGCTCCAGAGCATCATGACGAGTGCCTTGGT
TGTGAAACATGCGAGCAGAGGTTGAGCTACGACAGCCCAGCAGAAATATTACA