Description :
From Genome Similarity Track
Location :
contig_162:4677- 7141
Transcript NameFunction/comments
g13952.t1hypothetical protein

Sequence
2464 bases(100 bases per row)
CGTGCAACCCACCATACTAAGACCAAGTCAACCTGAATGCGAGTGCGCGGACACGACGAAGGAGACCGCCAAGAATCCAGTAGACCAAGTCAGACAGAAG
AAGAAGATAGTGATAAGAAGAAAACAGAGTTTGTTTTGCGTTGGAAGTGAGAAGTGGTGCCTTGTCGGCCCCCTTGCTTTGAGCGTACTGCGTTGAGGAA
GACTGCTGCGACCTATAGCGACTACTACGAGGCTGCGACCCGGGAGCGCTGGCGTATCGGACGACCAAGACCGCACGAAGATCGAGGAACCCGTGCGAAA
ACTCTCACCTAAGTCTAAGTCCCATTTAGGTGGGGACCAGGAACTCGTATCCCTGGATTGATCCGCCTATTTCATTTGTCAGTTGACTGTGGTTGCTTTA
GAGTGACTGCTTTCATTTCATATTCACCTACGATTCGGGAGGTTATTAGCAATCCCCCTGGATTTTGATAGTAGATTGCTGTGTGGTTCGAAGGAACTTG
TATATTTCTCCCATCCGGGAGTGGTGCGCGGAGGCATCCCGAATTTACCTGTATTCGGGACTGTAACTCATTCGGACAGGCTGTATATTGTGAGTGTATA
ACAAACTCTGTTGTTGTTTCTGTATTGCTTTTGGTTATATTGGAGAAGGTCTTTGTTCGTGACCCCACTCCCAGCCAAGACACTCCGGACTGTTAGAGTC
TGGTAGTCTCTCTACATATCTACGTATCCTGATCGAAGAACATCCCAAAGGTCAAAGCCCGGTCCGTCGAAGATAAACGACACCGATAGGGATTACTTCA
AGGTCACACGCCAAATCTCGGGGCAGACACTAGTTGTCTGCATTCGGGATTCTGACCCCGGCATCCGGACGCTCCCTCCTAGAGGAACGGGTACTCCCCG
AAGCGTTCGGGTCGTCTGAGTTCTCGAAGCTCGTTCGTCTGCCGGCACGACTGTACACCCTGGACGATAAAGGCGTTCACCCGCCTCGCCTCAGAGACAT
GCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCTGTCGCTCCATTGATGGAACGAATGCGCGTAGCTCTTCATGGTGTCAACCAACACGCGGTT
GACACGCTCTGTTTGTCCGTCGGTCTGTGGGTGATCCGCAGGCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAACCGCGCTGTA
AAGCGCGGACCCCGATCCGACACGATGTCGAGTGGTGTCTAAACACCATGTCAACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGC
AGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATG
GACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGCAGGCACGAACGTACT
TGCGTACCCATTTGTACTGGTGACTCCAGTAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTA
CTCGTACGTGATCTTGATCTTCAACTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACA
CGATAACGGTGTACACGAGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAAGTGTGGAGAAGTACTCCAACAACTGCTTCGCATCCGCAT
CATGCGCGTGTGCGGCCTTCACGTCATCCAACAAGGACGACGAGGGAATAGTCGGCCTCTTGCACCGTATAACCTGGTCGACGCGAAAGCACGTCGGCCA
CGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGAC
CGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGT
TCCTTGTCATGTACCGGGTAATTACGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTG
CGCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGACACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGAC
CGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACG
TACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAG