Description :
From Genome Similarity Track
Location :
contig_8:467632- 469151
Transcript NameFunction/comments
g1885.t1hypothetical protein
g1886.t1hypothetical protein

Sequence
1519 bases(100 bases per row)
CACTCTAGCTCACGTTGAGTTTCGCCTTAATATCTAGGTGGCCTCCTTGAGACGCCCTGGGCACCCACAGCACCAGCGAGCCACCTCCTGTGCCAGGAAG
CCCAAAGAGACCCGGACGCCAGCGGTCGAGGTACAGCGTCTTGCCTCCCAGCGCCGTGATATTGGACGTCCACTTGGCCTTGCCGCCCGCAGCGACATCC
ACCTCGTCTATTTTGTCTCCTCCAGACATGATGTTCACCGTGACGTCCTCCTCGTCCGTGCTTTTAAAGTTGATAATGACTTGGCCGTCTCCTTTCTTGG
TCCACGACATGGAACTACCTTTGAAGGCGTCTTGCAGCATATTCAAGCCCAGAGTGGCAGCTTCCGTGCCGTCGTCGATCTCGCCCATGAACTGGGTGGG
GCCGCACACCGTCTGGAGGTACTCGGAAAGCAGCAGCGTGAGGCGCGTGGGGTCGACCAGCATGGCGGCGACTGCGGAGAGGCCAGTGTCGATCACTTGT
ACGCAGTCTGCTTCTCGTCCAACGAGGTGCCGTTGTCGCTTTTCCCGGACTCGATGAGATCGTTGATGATCACTCCGAAGGTCTTTCGCAGTGTTTCGCG
CGTTGTGTAGGCGGTCGCTTGGCTGGATTCGGAGACCATTTGCTTCATGCAGTTGTTGGTCACAGTGGGGACGTCGTACAGTACCAGGTCAGACTCGCTG
ACTTTCAAGCGAATTTCATCGTCCGTGATGGCGGGGTCGTCTCGTCGATATTCGTTTACAGTCATCCAGACCCGGTCGGTTAGAGACTTTAGGTCGCCGC
CACACGAAGAGTTCTGCTTCATTGCTGTCTCCAGTGACTTAATCTCGCCTTCCGTGATCTCTTCAGCGGCCGCCGTGAAGTTGGCCCCCTTCATGAAGGC
ACGGAACTTCTGCCAGTTCATCAGGATGTCATCGTCGTTGGCAAGCACTTGCATCAACATCCATTGAGCCGTGCCCATCACGTATTGCGACAGCCTCAGA
TTTGGAGGCACGGCCTTGCCCATGCAAACGTAGATGGCGATAGGTAAATCCGTGACTACCGTACCCGTCTGGTACAGCAGCAGGAGCAGCTTGCGATCCG
TGGCTTGCGGGTCCTCCACCTTCATATTGCGGACGTATTTGATGATGCCTCTCATCACGAGCATGAGCGAGTTGGAGCACCGGACGGCCCAAGAAATCGT
CTGCCCCAGCTTGGCCAGCTCGCCGAAAACGCCCATCGTCGCAGTACTGAAGATGGACATGGCTACAGCGGAGACCTTGTTGGCCACTTCGATGCCGCAG
TCACTGTTCTGCTGGATACATTCCGCGCCGCACTCGACTGGGTAGTCCATCGGACACTCCGTCCAACAAGTGTTGGTCGCGTCATTGCGATCGTAGTTGC
TCGGACACATATCCATGACGTGCGCTTCTCGGTAGCACGCGGCGTCCGGTGAAATACTCCAGGGGCCTACCCAGTTGCGGTACGTCGACCGGATTGTGCT
CGTGGCCGTGGCGGGGGTA