Description :
From Genome Similarity Track
Location :
contig_8:467599- 469118
Transcript NameFunction/comments
g2022.t1hypothetical protein
g2023.t1hypothetical protein

Sequence
1519 bases(100 bases per row)
CACTCTAGCTCACGTTGAGTTTCGCCTTAATATCTAGGTGGCCTCCTTGAGACGCCCTGGGCACCCACAGCACCAGCGAGCCACCTCCTGTGCCAGGAAG
CCCAAAGAGACCCGGACGCCAGCGGTCGAGGTACAGCGTCTTGCCTCCCAGCGCCGTGATATTGGACGTCCACTTGGCCTTGCCGCCCGCAGCGACATCC
ACCTCGTCTATTTTGTCTCCTCCAGACATGATGTTCACCGTGACGTCCTCCTCGTCCGTACTTTTAAAGTTGATAATGACTTGGCCGTCTCCTTTCTTGG
TCCACGACATGGAACTGCCTTTGAAGGCGTCTTGCAGCATATTCAAGCCCAGAGTGGCAGCTTCCGTGCCGTCGTCGATCTCGCCCATGAACTGGGTGGG
GCCGCACACCGTCTGGAGGTACTCGGAAAGCAGCAGCGTGAGGCGCGTGGGGTCGACCAGCATGGCGGCGACTGCGGAGAGGCCAGTGTCGATCACTTGT
ACGCAGTCTGCTTCTCGTCCAACGAGGTGCCGTTGTCGCTTTTCCCGGACTCGATGAGATCGTTGATGATCACTCCGAAGGTCTTTCGCAGTGTTTCGCG
CGTTGTGTAGGCGGTCGCTTGGCTGGATTCGGAGACCATTTGCTTCATACAGTTGTTGGTCACAGTGGGGACGTCGTACAGTACCAGGTCAGACTCGCTG
ACTTTCAAGCGAATTTCATCGTCCGTGATGGCGGGGTCGTCTCGTCGATATTCGTTTACAGTCATCCAGACCCGGTCGGTTAGAGACTTTAGGTCGCCGC
CACACGAAGAGTTCTGCTTCATTGCTGTCTCCAGTGACTTAATCTCGCCTTCCGTGATCTCTTCAGCGGCCGCCGTGAAGTTGGCCCCCTTCATGAAGGC
ACGGAACTTCTGCCAGTTCATCAGGATGTCATCGTCGTTGGCAAGCACTTGCATCAACATCCATTGAGCCGTGCCCATCACGTATTGTGACAGCCTCAGA
TTTGGAGGCACGGCCTTGCCCATGCAAACGTAGATGGCGATAGGTAAATCCGTGACTACCGTACCCGTCTGGTACAGCAGCAGGAGCAGCTTGCGATCCG
TGGCTTGCGGGTCCTCCACCTTCATATTGCGGACGTATTTGATGATGCCTCTCATCACGAGCATGAGCGAGTTGGAGCACCGGACGGCCCAAGAAATCGT
CTGCCCCAGCTTGGCCAGCTCGCCGAAAACGCCCATCGTCGCAGTACTGAAGATGGACATGGCTACAGCGGAGACCTTGTTGGCCACTTCGATGCCGCAG
TCGCTGTTCTGCTGGATACATTCCGCGCCGCACTCGACTGGGTAGTCCATCGGACACTCCGTCCAACAAGTGTTGGTCGCGTCATTGCGATCGTAGTTGC
TCGGACACATATCCATGACGTGCGCTTCTCGGTAGCACGCGGCGTCCGGTGAAATACTCCAGGGGCCTACCCAGTTGCGGTACGTCGACCGGATTGTGCT
CGTGGCCGTGGCGGGGGTA