Description :
From Genome Similarity Track
Location :
scaffold_165:46753- 49378
Transcript NameFunction/comments
Pl_108460pyruvate dehydrogenase E1 component subunit alpha

Sequence
2625 bases(100 bases per row)
CACTTCTCAATCCTCCAAGCAGAAAGGAAGCAGAGACACCGTCGAGATGATGATGATGATCCGCTGTTCCACCGTCGCGTTGGCTCGCAACGCCACACGC
ACCTTCAGCTCGCCATGCCCTTCGAGCTGCATCGTACGTCAACCACAGGATCGTCCTAGTTGATATCTAACACGTTATTTTGTTTATATAGGTCTCGAAG
AGGGCCCGGCGGAGTTCGCTGTGACCAACCGTGAGGAAATGCTTGAATACTACAAGCTCATGTACACGATGCGCCGCATGGAGATTACCAACAACAACGA
GTACAAGGCCCGCACTATCCGCGGCTTCTGCCACTTGTACGACGGTCAGGAAGCTGTAGCAACCGGTGTGGAGGCTGGTCTGGACCGGATGGACTCATGG
ATCACGTCGTACCGTAACCACTGCATTATGCTTGCTCGTGGCGCTGAGGTCAAAGACGTCCTGGCTGAGCTTTTTGGCAGGAAGGACGGCGCTACTGGTG
GTAAGGGTGGATCCATGCACTTCTACAAGAAGGAGACCAACTTCTACGGTGGTCAGGGCATTGTCGGTGGTCAGGTACCGGTCTTGCCTTCGCTAACAAG
TACAAACACAATGGTAAGGGTCTGATGCCCTGTGCTATCACTATGTTCGGCGATGGTGCCGCCAACCAGGGGCAGGTATTCGAGGCTGCCAACATGGCTG
CTCTGTGGAAACTACCTGTGATCTTCTGCATCGAGAACAACCACTACGTCTACTCAACGTGCGACCTACAACGCGGACTACTACACCATGGGCAACAAGA
TCCCTGGTATCAAGTGCGATGGTAACGATGTGCTCGCTGTGCGTGAGTGCACCAAGTTCGTGAAGCAGTGGTGTGGAGAGGGCAACGGCCCTATCTTCGT
GGAAATGGACACGTACCCCACTCCATGTCGGACCCTGGTGTGACGTACCGCAGCCGTGACGAGATCTCAAAGATGCGTGCTTCACGTGACCCCATTGAGC
TCGTGAAGAAGCGTATGGTCGAGACCGAGCTTGCTACAGTTGACGAGATTAAGGAGCTGGAGAAGAAGGTGCGCGCTGAAGTTGTCAAGGCCACCAAGGA
GGCGAAGGCCTCAGACAAGCCCGATGAGTCTGCAGCTTTTACGGACGTGTACACCGATGGTGAGGGCAACAACGAATACCCGCCGTTCGTCCGTTTCCCC
GACTACTCTAAGAGCCTATACAACGGCAAGCCCCAGCAGTAGGTGCAGCACACGAAAAGCGGCGTGACGTCGCCACCTTAGGACTAATGTGCCTCGACAT
GCGGTAGAAGCTGCGCTGCGTCACCTATTATTTCGTCTCTACTTCAGTTCGCTGCCAGCGTCGACCACATTAATCCGGCTGAACACCTGAACACCTGAAC
GCCTAAAGCATCACATTTGCCCTACCGTCGTGACAATAGTAAATGCATTACATCGATTCATGCCAACCCCACACCGTCTTCCTATGTTAGGTGGAAGCTG
CATAGATCTGGATGCTGGCTGCACGTGTGGCGCTGGATAGCGAATTCCTGCGATCGTGTCATACCAAGTGTATTACATTTGAGTTGAAAACCCAGCAATT
AACCATAACAGTCATCGCCCACCCAGCCAACTGAGCAGTAGAAACAGATTGAAGATGTGCATCTTCATCAATTGACATCGTCTGCGTTAAGATCCTCATA
AAAGCTTGCTCAAATTAACCATGACTCATTTGTTGCTGTGATTGCTACACACTACTTGACTACTAACTAGTTCAACGTCAGGCGCTTCGTGTGTGTCTGG
TACTTGTTTTCAAATTCTTCCAGCACGTTGGAGCGGACAGCGATTTAGGTGGAGTACAACACGGCTCCAGCACCAGGTGCCACTTTGAAATCACTGCCGT
GTCAGCGGTGACGGGGTCGACGACGCACTACTGGGCTATTGCTGGTTTTGCTGCTGTTGCCTCCGTTTCGAAGCATTGGTGCCATAATTTCATGCTCTTG
TTGCAGTGCCACAACGCGAAATTGCGAGAGCTTTCGAGCTTGTTGGGCGAAGCTGTTCGCGTAGTTTGCGGCGACATTAATGTTGTTAGCGCGAGCAATC
ACCTCGTTAAACTCGAACTTTCGTGGTCTACAGCAGATAAATGAGTACCTTGGTTTCTCTCATGATTGATCTGGATGCGTGAGTGAGCAGTGCGAAGACT
GTGAGGTGAGATGCGTCCATGCACAGGTGACGGTCTCGTGATTGAGTACGTGGTGGAATGGACGAAGATGCAGTAGACTCGTCGTCCGTATTATCGTCCG
AACCGTCCTTAGTTTGTCGTTCAGCGTTCAGCGTTGCCCATGCCCATTTGGCGTAAACGGAAGGCCATGGCCAAGTCTGCTGGGCTGCCACAGCGTTTAG
CAGCAAACAAAGCCTTGTTACGTATCACGACGCCGTCGCTGAAGGAACAACTCGGGGAGGCTGGCTTGGGCACACCGATAGAATATACAGTTGTGACAGT
GAGATTGTCTTTTGCATCCGATGAGAACGTCTTGTACTCGGCACAACAAGATGCCCGCTTCGATTTTGTTTTACTTCATCTCTATCGACTGAGAAACTCT
GCGTGCTCCCCCGTGTTCTTGCTCG