Description :
From Genome Similarity Track
Location :
Scaffold_410:4675- 9817
Transcript NameFunction/comments
Hyaar_Emoy2814079retrotransposon protein, putative, Ty3-gypsy subclass
Hyaar_Emoy2814080pol protein putative

Sequence
5142 bases(100 bases per row)
GTGCTGTGTGACCCCGTCACACCTGGTAGCACTTGTAGTCAATCCCGCGACCAAGGATTGATACAATCCGCAAGTTGTATAACATGGATGACTTGGAAAG
TAAGATGCCTTTGAGGCATGACTATCCTCATCTTTCGGATGCCCATTGGGCTACGTTGGAGCGAATGGTTAGCCTCTTAGGCAGGGAGACTTTCGTCGGG
TTCCCCTCCCTAACCGCCGAGCAGCAGCGTGCTCGAATGGAGCGGTTTGAGAGCTATGAGTCCTCACTCATCGCTCATGTGAACAAGACGGCGCAAGAGG
CGGCTCGTGCCGTCGTCAGAGCCGAGGCGCAGAGCGCTGCTCCGACGCAGGTGTCGTATACGCCACGTCCAGAGTCCTCGAAAGCTGTAAAAGTTAGTGT
CCCTACGTTTGATGGGAAGGAAGCAGACAGCTTGGTCTTTTGCATCAGGGAGATCGAGATCGCGCTGAGCGCAGGCCAGATTCACGACGCGAGGTCCCAA
GTGGCCTTTGCCCTTTCGAACCTGGGAGGTCGGGCAAGGGCGTGGGCTATGGCCAAAGAGAAAGCCACTCCGGTATACTTTGTCTCGTGGGAGTTCATGG
CGCAGGGGATGCGTCACACATTTCTCCTGGCCAATGTGGCGTACCGTCATCGGTCTTTTTTATTGCGGAGCAAGCAAGACAAGAGGTCCTTGCAGGACTG
TGTCATGGAGCTTCAGAACTTGGAGGCTGCCATGGCAGGGGCTCCGTTGTCGGAAGAGGTGAAGGTCACCGTGTTCATGGGTGGTGTCCGGGTCGGACCC
GTCCGCACGGAGCTCATTCGTCGTCAAGCGACCACGTTCAATAAAGCGGTACATATCGCTTTGTTGGAAGATCACTGCATGCGGTCGGCACAGGGCCACG
TCGGGGCTACGGAGGCCTCGGAGGGTTCTACCCCCATGGATTTATCGTCGGCTGAGAAGACTCGCCCGCGTTGGTGTGCGTCAAGGGCCGGCGGCCGCTG
TTTTGGGTGCAATGCGGTCGGGCATTACCGCAGAGATTGTCCTAATAACCCGTAGAAGGTTGTCCACGCCAGCTTCAGCGAAGAACTCTCTTAACACCGT
AAGCGTTGTAGAGTCGGGAAACGTCGACTCCCAGTAGGTGCGGGACGCCCTACTGGGAGGTCAATGGCTTCCAAGACGGGAGGGGATTTACCCCCTCCTC
TTCCTGGAGAAGATGTCCCGGGGACAACACTGTTGTGTTTGTCTGTGGCCGCGGTGCGGTCAAACTCAGTGGTGGTTACTGCTAGGGTGAAGGGGTACGA
TGAACCCATGACGGTCTTGATAGACTCAGGCGCGTCATATAACTTCGCGACGAAGGCTACTGTGTCGAAGAATCAGGCGCTGTATACCAAGTCTGTAGAA
GACTCCAAGAGTAACAGCAAGGTGTCAGTTCGCTTAGCGACAGGATCGATTGTATCGACTCGCAAGGTTTTGATACCTTTGGTAATCGAATGTGATGAGT
TTAATTCAGAAGAACCGTTCATCGTCTTGGACATGGACGATCGATACGATCTTATCCTTGGTATGCCATGGCTTATGAAGCATGAGCCATGGATCGACTG
GCGTAGTCGCACCTTGGGTGCTAGTCACAAATCCCTCGTGGAACGAGCTTTGGCGGGTCATGTCCCCTCCATGTCTCGCGATGGATTTGTGCACGAACAT
CACATCTCACGTTCGGAGCGCCTCTTTGCCGGTTCGGCAGAGGCAATGTGTGAGAAAGGTTGTCGCGGATCGACTGATACCTTGGAAGGCGTTCAGGCTG
GGGCATCCTCCGCACGAGAAGTCGCAACCGTGGGTGGTGGTGCAAGTGGTAGTGCTGTGTTCACTATCGCTCAGGAAGTCGCAACCGTGGGTGGTGGTGC
AAATGGAAGTGCTGTGGTCACTTCGGCTCAAGGAGCAGGTGTCGTTGGACGACACATACATGAAGGAGTTGTGTTTCATCCTTCATCGGAAGACGCAACC
GTGGGTGGTTGTGCGAGTGGTAGTGCTGTGGTCACTATCGCCCAGGAAGACGCAACCGTGGGTGGTTGTGCAAGTAGGGGTGCTGTGGTCACTCTTTCAC
AGGAGGTCGCGGTCGTAGATCGAAGCGGCTTGGATGGGATTGCGGTGGAACCACTTCCCAAGCTCGAAGAGTTGTACGGGATTGACGAATTGTCCCATCG
GGAGTTCCTAGCGGCCCTCAAGGAAGGCGCGTTAGAAGATGTGGTGCTCATACGTCAGGAAGTGACGTCAGTGGAGCTGAACAGTTCTTCGGTCATGGAC
CCAGAAGTGTTGGATGAGGAGAACAAGTCTCGTCGTCAGCAAAGGTATGGCTCGGCCATCTTGAAGAATCCAGCGGATCCGTTTTATCCGCTGCTAAAGG
AGTTTGCGGATGTGGTCTCGGAAGATCCTCCGTCAGTGTTGCCCCCGGATCGGGGTGTACGGCATGAGATTGACCTGGAACCGGGTACTAAGTACTGTAC
TACGCGTCAATGGCCGCTGCCCAAGGAGCAAGTGGACGCAATAGATGCGTTCTTTGCGGCAAAACATGCTGCGGGCATGGTTCGAGAATCGAAGTCGCCA
CATTCGTCCCCAACGTTCTGTGTGCGGAAACCCAATGGGAAATGGCGCATGGTGCATGCTTTTCACAAGCTGAATGCGGCTACAGTTCCGGCGTCGACGC
CAATCTCCCGCAAAGATGTGTTGCAAAACAATATGGTGGGATGCAGCATCTTTAGCGCGCTCGACATGGTCGACGGCTATTACCAGCTGTTGATGAGGGA
ATCGGATATTCCCCTCACGGCAGTAAGTACTCCCAGTGGGATGTTGTGGGAATGGTTGGTCATGCCCCAGGGGATTTCCAACGCGCCAGCCACGTTCAAT
CGGCTCGTTACCCAACTGTTTCGGCCGATGCGACACTTCGCGCAGACGTATTTTGATGACAACTTTGTCCACAGCAAGGCTGAAGGGGACAAGACGGATG
TTGAGGTGCATATTGGGCACCTTCGGTCAGTGTTGATGTGCATGCGAGAGAATTGTCTACTTGCGAACATCAACAAGTGCCTCTTTGGGGCGGAAGAGAT
TCCCTTTTTGGGATGTTTCCCTGGGAGGATGGAATTCGGGCGGATCCGGAGAAGGTACAGGCGATTGCACAGTGGCCCACGCTCAAGTCCCAGAAAGATC
TACGCAAGTGGCTGGGACTTGCAAATTATTTGCACAAGTACAGCGAGAATTATGCTGAGATGGACAGGCCATTGACAAACTTGCTGAAGAATGACGTGAT
ATGGTCATGGTCGGGAGAGGCCCAACAGGCTTTTGAAGCCATCAAGTTGGGCCTACAATCAGCACCAATTTTGGCGTTACCGGACGAGGATCGTCCGTTT
AGTGTGGTGTGTGATGCGTCTGATTTTGCCATTGGCTGTGCGCTGCTTCAGCTGGATGCCAAGGGCAACGAACGTGTGATTTCTTTCCAGTCGTGGCAGC
TCAAGGCCTCCGAAAAGAATTACCCAGTGCATGATAAGGAACTTCTTGCGATGAAGTATGCACTGGCTAAGTTTTGGGTTCATCTGCTAGGTAGTAAACC
CTTCGTGTCTACACAGACCATGCCTCGTTGAGGACGGCGACGCAGTCGCCACACTTGTCGCCACACTTGTCGGAGCGCATGGCGCGTTGGTTGTCATTCT
TTGCGGAATACAACTTCACGGCGGCTTATAAGCCAGGGAAGCAAAATGTGCTAGCTGACGCGTTGTCAAGGCGTCCTGATTATGAGCTGGCACATGTGGT
GCACCTTGAATCGACACTGTTTGAGCTCATACGCGGGGCGAATTCTCTAGATCCGGACTTTCGAGGTGTTATTGAGGCGCTGGGCACCTCATCGAACATC
GTCAAGTTGACGAAACGCCAGCAGGCACATCTCCATCGGTATAGCCTGTCCGATGGACTTCTGCTCTACAGTGTGAATCTTGGGGATGAAAAGCGGGTGG
TCGTTCCAAACGACGAAGATTTACGCACTGGATCCTCTACGAGGCACACGATACGCCTGGCAGTGGTCACTTGGGGCGCGAGAAAACGTATACGTCTGTT
GCAGGTGAATTTTGGTGGCCCCACATGTACAAATGGGTGCGGTCTTACGTTAAGACTTGTGAGACTTGTCAGCGGGTGAAGCCCCTACCGTCCTCAGCAG
CGCCGTTGCATAGTTTGCCAGTCTCGGAGGACTGTTGGCGCTCAGTGAGCATGGACTTCATCTTTGATCTACCGGCAGACAAGCCATACTGGGATTATGG
TTTTCGTGTGCCGCCTCAGCAAGATGGTGCAATTAGTGGCGGTTCGCCGAAGTGTTACGGCGCCGCAGGCGGCCCAACTCTTCATTAATCATGTGTTTCG
ACATCATGGACTCCCGGAGTATTTTGTGAGTGATCGGGATCCTCGTTTCGTTTCGGCCTTCTGGCAGCATCTCTTTCGGCTGATGGGGACTCGACTGGAT
ATGTCGACAGCGGATCATCTGCAGACGGATGGTCAGACCGAACGGGTCAACCGTGTTTTGGAAGATGTGCTTCGCAGTGTTTGTGTGGATAAGCCATCTC
AGTGGAGCGCTCAACTCGCGCAAGTGGAATTCGCGTTGAATAATGCAGTGCACTCTTCTACGGGTTTTTCCCCGTTCTATGTGAATGGGTTGCGGCATCT
GCGTACTCCCCTATCGTTGCCGAGGGCTTCTGATTTGGAGGGGGGAGAGGCTGTCGCCGATGACCTAAGAGGTCTAAGTGGTGTTCGACCATCGGTCAAG
CGTAATTTGCTTACGTTTATTGAGACTGGTGAAGTCATTCGGCTCCGCGTAAGAGACACCATGGCTGCCGCTCAGGACCTTCAAAAGGAAAACAGTGACC
GCCATTGGCGTCGGAACACACAGGTGTTTAAGATTGGCGATTTGGTGTTGCTAAATGCTCGCAATTTACCTATACACGCAGTGTTGGCTGTAGGGAGTAC
AAAGCTTCGTCTGCGCTTCGTGGATCCGTTCATGGTCATTTGTGTGCATGGCAATGCTTACACTTTGAACTTTCCATCGGCTATGGCAACGCATCCAACG
TTCTACGTTGGGATGATTAAGGTCTACCTTGATCCCTCTGCT