Description :
From Genome Similarity Track
Location :
Scaffold_1235:4675- 6512
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1235-snap-gene-0.2Histone acetyltransferase

Sequence
1837 bases(100 bases per row)
ACGGAAGCGCAGCTGGACGAGCACATCCGGTCTCTTCGGTTCAACTTCTGTGGCCACATCACGCTGACCGAGCTGAAGAATCGACTCCTGCCACTTATTA
ACAAGCTTATGGAAAGCGAGTACGGATGGACATTCAACAATCCAGTTGATCCAGTGCAGTGGAATATCCCCGACTACTTCGAAATCATCAAATGCCCAAT
GGATTTGGGAACGATCAAGAAGCGACTAGAGAATGAGCACTACAACAGTGTCGAGGCTTTTGCGGGCGATGTGCGACTGGTATTCGAGAACTGCATCGCA
TACAACAGCAGTACGAACAAGTTTAACATCGCTGCGAAGCAACTGCTGGCATCGTTTGACAAGTCGCTCGCTGCACTGAAGAACCAGCTGGAGAAACAGC
TATTCAAGCGCTGCGAGCAACGACGAGAGGAGATGTGCCAACTCTGTGGAGGCGATTCGTTCAAGTTCGCTCCATGCATGTTGTTCTGCAGTGGACCGTG
TGCTGGTCGCATACGTCGCCACACTCACTACTACAGCGATCCACGCGGAGAGCACCATTGGTGTTCAAGCTGCTACAAGCTGATGAAGGACGGACCGATT
GACATGGCGACGCTTCCTCAACTGACTGCTGCCGCGCCTGCGGAGGGAGGCACTGGTGCAGGTGCTCCAGCTGGCGTGGCAATAGTGCCGTTTGATGGTG
TGCTGAAAAAGTCGTCTTTGCTGAAGCGCAAGAACAGTGAAGTCGCTGAAGAGCCGTGGGTCGAGTGCGACTCGTGCAAGTTGTGGTACCACCAGATATG
CGCGCTCTTCAACGAGCGGAATCACGCTATCTCTGGTGAGCAGGAGCCGTTCGTGTGTCCAATCTGCGTGAAGAAGCAGCGGGTGGCTGGTGTGAAGCCA
TCTACGGAGAATGGCCTCAAAGCGAGACGGCTGCCGATCACACGCATGGCGAGATTGATCGAGAAGCGAGTGATGGAGTCGATCGATCAGGCAGGAAAAG
ATGAAGCGGAGCGCATGGGCAACTTGGGAAATTCAGACAGTATCGGGTTTTCTCGCGGGGTTGACGAGCCAGCTTCGGAAACCCAGTTTGGTGTCACAAT
TCGAGAGGTGTTGAGCATTGACAAGCAAGTCCAGATCAAGCCAAAAATGGGAAAGTTGCTGGCTGCGAAGTACGCGAAACCGAAGAAGACTGACAGCAAG
AGCGGGAACGGATCGACTGGAGGAGCGGAAAAGCCAAAATCATTGAAGCGACAGCGGACGGAAAGCACGAAGAAGCGTCAGAATGGCGGGGCTTTAGCTG
CTAGTTCTTCTGGTCAGCCTCTTCAGCTCACGTATCGCTCGCGGTGCATATGCGTCTTCCAAGAACTCGACGGCGTCGATGTGCTCATCTTCACATTGTA
CGTTCAAGAGTACGGTCCCGACTCGCTCGATCCCAATTCTGGGCGCGTGTACGTGTCATACCTGGACTCCGTCAACTATTTCCAACCGAAGAAGCTACGA
ACGCTGATGCATCAGCAAGTGATGCTAGGGTTTCTGGAAGACTGCAAGAACCGCGGCTTTCACACTGCGCACATCTGGTCGTGTCCACCGCTGAAGGGCG
ATGATTATATCTTCTTCTGCAAGCCCGAGAACCAGAAGATTCCGAAGTCTGCAAGACTGCGTCAGTGGTACCAGAAGCTTCTCCAACAAGCCAAGAAAGA
CGGCCTCGTGTACAACGTTTCCAATCTGTACGCGGAGTATTACATGAAGAAGAAAGGAGCACACGACCTGCCATACTTCGAAGGGGATTACTGGCCGCGT
CTTGCGGAAGATCTGATCAAGCAGCTCGAGGAGAAGA