Description :
From Genome Similarity Track
Location :
scaffold_3:46745- 48194
Transcript NameFunction/comments
g6075.t1 hypothetical protein PHYSODRAFT_330557

Sequence
1449 bases(100 bases per row)
CCAACACGTGTCTTACGGATACAAGACACACCGACACAAGAAATCTCTCCGATGCCGTGGCTACAAGACGTGTTTCGAGCCCACGAAATAATGGCCCTCC
ATTCGGCGGAGACCTACGCCGACATGAGCGCCGAATACATCGCTATGGGTTGCTCCTACGCCATTCTTTTCTTCTTTGGTTCCCATCCAAAGTTCACGCT
TGGCACCCAGAGTGTAGACATCACTACTATCGTCCTCCAGGTGCTGATCGAACTCGTTGTAGACTTTGTGGCGAGCTCGTTCGAAATCCACCACAATGTC
AACTTCGACCACATCAACTCCGACACCGCCTATCTGTCGTTCTTCTCGGCGGTTGTTGCTGCAGCGAACATTCACATCTCGTCTGGCATCTACTTGAATC
CTCAGTGAGACGCTGAGTTCCGAGGAAGAAGCTTTCGTAATGTAACAATGTTGAAAAATGTTTTAATGGTACAATGGAAGCGCTTCTTATCGTTCTCGAC
TCTAATAAGCTGACTCAACTGCAGATTCTTTCAAGAGCAAGCGCTCAATCCACGCGAACTCCTGTTTCTGTGTGTTGTCATCGGTTGAGGTATTTTCCTG
GTCGTGGGAGACCTGATGGCGCGACGCCCACACCATCGCACACGTCAGGTTTCGTCGGTCCTCAGCAAAAATGTCCGCTTGGTGTTGCAGTAGTTCGTGC
CAGATAGCCATATTTGACGCATATCCTCGAGCTAGCACGTGCAGCAGGGTCTCCTGCTGGTTGTTACGTGCTCGAGCGTCGGCTCTGTGTGCAAGTAGAA
GCTTCACAACGGAGTCAAACTCGTTGCGCACAGCACCAAACAACGCCGAGTCGCCGTCGTTATTCACCGCATTGACCTCAGCACCGTGCAGCATCAGCAA
CTCCATCATGGCGTACTGCGTCGTCTGGTCTCCCAAGGCAAAATGCGGCGCCGTGCTTTGACTCAAAAAGGCCGCGTCGATCAGCGCCGTGTTGCCATGC
TCGTCTCTCGCTTCCACGTCGCTGCCGAACTTGATGAGCGCCTCTACGACCGCGCAGTTGCCATTCGGTGCTGCAAAATGCAGTGGCGTAGCTTCCGACG
CATTGACAGCGTTCGCGTCCGCCCCAGTTTCCAAAAGGAACTGCACCACGGGTAGTGAACAGTAGGCGGCTGCGAGATGAAGTGGCGCGTTGCCACCGGC
GTCGCGTGCCTCGATGTCCGCTCCTCTCTCCAGCAGCCACTGCACCGCGTCCAATACCCCGTACGTGGCCAACACGTGCATCGAAGTCTGCAGCGCTGCA
TTCACATGGTCGACGTCGCACCCGTAGGCGATCAGCATCTCGGCCGCTCGGAAGTGACGTCCGACCAACGCCGTCGTCAATGGCGAGGCCCCGGAAGCGT
CTTGAGCGTGCAGTGTGGCCCCGTTTTCAAGCACGAACTCCAGCAGCGA