Description :
From Genome Similarity Track
Location :
Scaffold_47:46740- 48742
Transcript NameFunction/comments
Phyag_g1162hypothetical protein

Sequence
2002 bases(100 bases per row)
AGATCTACACGTCAATTGGCGATATCCTCGTGGCGCTCAATCCGCTAAAACCTCTGCCGGAGCTCTACTCTGTGGCGCAATTAGCCGCATACAAAGCGGC
AATGACAGCAGAATCAACGGCTCTGCGACAGAACGAACTGCCGCCGCATGTATACGCTATCGGCGGCAAAGCGTTTAGCGGACTGCTAAAACCCGAACGA
CGCAACCAGAGCATCTTGGTTAGCGGCGAAagtggcagcggcaagacCGAGAGCACCAAGTTCTTGATGCAGTTTTTAACCAGTGTGGGATGCGACCAGT
CGTTATCCACTGCGCAAACGAGTGGCGCAGTGGAGATTGGCAGACGCATTTTGCAGACCAACCCGATTTTGGAGTCTTTCGGCAATGCGCAAACCATCCG
CAACGACAATTCCAGTCGCTTCGGAAAGTTTATCAAGATCCAATTTGGCGACAAGAACGAAATTGTTGGCGCGCAAATTGTCAGCTACTTGCTCGAGAAA
GTGCGCCTGTTGCACCAAAACCCGGAAGAACGCAGTTTCCATATTTTCtatgagctgctcgaaggaGCGGACCCGGAGCTGCTAACTGAATTGGGGTTGA
AAAAAGGGGGCAAATACGAACTGTTGAATTCGTACGGACCCAATTttgcgcgacgacgagcagtggCAGACAAATATGCGCAATTGTATGTGGAGACTGT
ACGAGCTTTTGAAGATACGGGGGTTGGGGAGCAGGAACGAACCGACATTTTCAAGATTTTAgcggcgttgctgcattTGGGAAATGTCAATTTTGCGGcg
gatggagaagacggcaCTGCTGTGACTGCAGCGTCTAGATTTCATTTGGATAAATGTGCGGAACTTATGGGGGTCGATGTGGATAAACTGGAGACTCTTT
TGAGTAGTCGAGAGATTAAGGCTGGCATGGAGGTTATGGTGTTGAAGCATAATCCAGAACAGGCTAAGGAGATCTGTCGGTCTTTAGCGAAGGCAATCTA
CGGTCGACTATTTACGTGGCTTGTGCGTCGTCTGAGTGATGAGATCAACTACTTTGATTCTGACATTTCGAtctcggacgaagacgaagaattGGCGACG
ATCGGCATTTTGGATATTTTCGGCTTTGAAAGTTTGAACCTGAATGGGTTTGAGCAGCTCTGCATCAACTATGCCAACGAGCGATTGCAGGCGCAGTTCA
ATGAGTTTGTCTTCGTgcgcgagcagcaggtgTATATTGCAGAGGGAATTGACTGGAGGAACATCTCATATCCGAGCAATGCTGCGTGCTTGGCCCTTTT
TGACGATAAAAGCAACGGCTTGTTCTCTCTACTGGATCAGGAATGCCTGATGCCGAAAGGCTCAAACCAGGCGCTGAGCACTAAATTCTATCGATATCAC
GGTGGAGAGGGGGCAGATTCAGCTGGACTCCTTCAGCAACCGCAACTTGCACAGAGCACTCTGCCGCTACTCATGTCGTCCTTCAGCAGGTACTTGCATC
GAACTGAGTCGCaggaggaagcagcacagcaggACACGAAGAAGCACCCGTTTTCGGCGTCTAAGATGGAACGTGTCAACCATCAATTTGTGGTTCATCA
CTTTGCTGGACGTGTGTGCTACAATGTTGAGCAGTTTGTCGAAAAGAACACTGATTCACTCCCCACTGACGCGAGCAGTATTCTGTGTTCTTCCAATAAC
GAAGTGGTCGTGGCAATCGGAGCTGATGAAAACGTGGACACTCCTGGTGCTGAAAACGGATCAACGGGGCGGAGGCGCTACTCTATGCTGCGCGCGCCTA
GCGTTTCATCGCAGTTTAAGAGTCAACTGGACCGCCTCATCGTCCAGATTGGACGCACCGAGGCACATTACGTTCGCTGCTTGAAGCCCAACGAGGTCAA
GAAGCCTGGTATTTTTGATCGTGAGAGAATGGTTGAACAAATGCGGTCTGTTGgggtgctggaagctgttcgTATCGCACGCCATGGATACTCTGTCCGC
CT