Description :
From Genome Similarity Track
Location :
scaffold_54:46728- 73884
Transcript NameFunction/comments
Pl_110994hypothetical protein PHYSODRAFT_505107
Pl_110995hypothetical protein PHYSODRAFT_346687
Pl_110996hypothetical protein PHYSODRAFT_315958
Pl_110997conserved hypothetical protein
Pl_110998conserved hypothetical protein
Pl_110999pumilio-like mating protein M90
Pl_111000hypothetical protein PHYSODRAFT_315962
Pl_111001P-type ATPase (P-ATPase) Superfamily
Pl_111002hypothetical protein PHYSODRAFT_346689
Pl_111003hypothetical protein PHYSODRAFT_351619

Sequence
27156 bases(100 bases per row)
TATTCTGTGTCTACCTGTTAAGTCTCCTGAGGGAACCATCCTAGCAGTGCTCTCTGCAGTGAATAAGGTTGATGGGATGGACTTCACTAGCGAGGACGCT
GTTTTCCTCAATTATGCAGCTGAAGCTGTGGGAACATCCCTGCACAAGGCAAGTTTGCACCGTGAGGTCAGGACGTCGCAAAAGCTCATTGAGGCAAGGC
TAAAACTTACTACCTTTATCTCCCAGAGTACCGATATCGCTGAGTTCGTGGATATGGTCATGGAATTAGGCAAGGATATCATGGAGTGCGATCGCTTTGG
TCTGCTGCTTATTGATCACTTCAAGCATGAACTTTGGATCACACCGCGCGTTGGTGGTGAGAGCATTCGTTCTCCTATGAATCGCGGGATTTCAGGACTT
GTAGCTACCACTGGAGAAACCGTGTGTACTCGAGATGCATACAAGCACGAACTATTCGACCCTAGCGTCGACATAAAGACAGGTTACCACACCACAAGCG
TACTTTGTATGCCTGTGTTCGAGGATCACTCACTCACAACTCCTCCTAAGGTGGTTGCAGTTGCCATGTGCATCAACAAGAAAGAAGGTGCCCACGTAGT
TGCATTCACTAAAACTGATCGTGAAATCATGACTAAGTACTGCGTAGAAGTGCAGTTTGCACTCGGTCGGCTATCTCTCGATATCTCGTACTACAAGGTG
GTGTCGGATTGCGTCGCAGTTTCTCGAACGAGTGCAGACTCGAACTCGCGAACTTTGAAGCGAATGTCGACCACAAATCGCATGGACAAATACTCCGAGA
CAGACATCATTTCTTCTATCGTGCATAAGTATTGCCATTCTGGCGACGATGTCGGCGGTGTGACCAAGAAGAAAGGCATATCCTCATTCGCAGCGTTGCT
ACCAGCTATCAAAAAGAAAAGTCATGAAGATGACGAAGTGCCATTTCCACGCGACATCATTTTCACTCATGGACGAGATGAACCACTAGACCATTGGGAC
ACCGAGACGATATCACTTTCGAGCAGTGAGGTGTCAATGAGCTGCAGCATTATTTTCCGCGCATACGGGTTCATGGACGCATTTCGCATCTCCAGTGAGA
AGTTCTCTGCTTTTACGACAAACGTGGCTAACTACTATCGTAGCAACACGTTTCACAACTTTCAACACGCTTTCCAAGTAATGGTGGCGATGCACATCAT
GCTACGCACCGAATGTCGCCGATATTTCAGTGGGCTCGAGATATTTTCAATGCTCATTGCATCGCTTTGCCACGATATCGATCATCCTGGAAACAACAAC
GACTTCGAGCTCAAACTGCTGAGTCCTATGGCGCTCACGCACAATGACGACGCAGTGCTGGAGCGTCATCACTGTCGTGTGACCTTCATTATTCTCAACC
ACAAGTCCGCTAAGATCCTACAACATTTGGACCATGAACGTCACAAACGAGTACGACAACTCATTATTGCGTGCATTCTCGCAACTGACATGTCCAAGCA
TTTCGAGAAGTGCAAGGTTCTTGAGGGTCTTACGCGTCGACAGCTCGGAGATAAACGATCTATCTTCATGAGCATTCTCATGCATGCAGCTGACTTATCA
CACTACGCGCTCCCGTTTTCTCAGGCGCAAGAGTGGGGTGCTCGTTTACTTGACGAGTTTCAAAACCAAGCTGCAGCTGAATCTGACCATGGTATTTCTA
CCGACTACTTCATGCAAAATCTGGAAAACAAGCGTGTTCGGATTACAGTTCATCTCAACTTCATCAACTACGTTGTGCGTCCAATATGGCTCCCGTTGAC
TTCGCTTTGCCATCACCTTCGGGTAAGTTGAATATTTGTTAGTTTATCAGCTCAGTTTGCTTACGTTACAGTCGCTGCAGTTCTACACAGACACGCTGGA
GAAAAATTACGAGATGTATAGACAACAACTGAACAAGGACAAGAGTTCGAGCAACGTGCTAGCGAACCCCTCGACAGCTACGATTCATGGTGCACTAATT
TCACCTCAAACTGTTACCAGAAGTGTGATACCTTCATCTCCTCGTAACATGCACAACACGAGTTAGTTGTCGCTCATGAAAAGTAAATGCTTCAAGTAGG
ACTGTAAGTAAGACCTCGATTAATGTGGGTTTATGCCTATTGTGCAGTCTTCATGTACATCAAGGCAAAACGTAGGCTCTAGTCGAAGAACAGAACGACC
ACCGTCGTGTCATCATGGCGACGTCGGCGGTGACTTCCGGGGGGTAGGCTCAGCAGCTCCTGGTACGTCATTCCGTAGCGCTTTGCCGCCTTCTGAAGCA
CACGTTCAACCAGCGCACGGCCTGCGAGATCGTGGTTTCCGCATGAAGCCTGACCATTGACCACCTCAACGGCCTCTTCGTTGCTGAGATAATCCCACAG
ACCATCAGATCCGATGATAACAAACTTGTCCCCCTCCGCGAGCTTATGCGACTTAACTTCCGGAATTGCCGTGATGTAAGGCGGCGTGTAAGGTGCCGAA
AAGTGGCGACCAGCCGAGCGATCACCGTTTTTGTAAGGCGGGCCATTGAATTCGGGGTGCTTGAGCGAGAAGTCACCAAACGCACGCGTCGGCTGAAGCG
CTCCCTTCACGTAGCACGAGTCTGGGTGACGGCACGTGAAGGCGTTTGCCTCACCTGGGTGCTCCTTGATAAGTTTTTCCTGCTCAAACTTCACCATCGC
ATTTTGGTCATTGCTCAGTGGTTCGGCCACGACCGTGTCGGGCTCCTTGCCGATCTTTCCCAATACGGCACGGATGTCACCAGCGTTGGCAACGTGAACA
GTGCCTTCGTGCACGTAGGCCAAACACGCACACGATCCGCAACGTGCTACAGCCCCGAATCCCAACTTAAAAGCTGAGGCCACCTCAGCCATGAGGTCAC
GATCAGTGCGTCCAAATGCACGTTGAATAGCCGCCGCAACGCGGTCATCAGAGACCGTCTCCTCGTCACCTTGAGCCGGCTCGCTCGTGCCCGGCTTGTA
CAGATATGACAGCTCCTTCTGTACGTTGCCGATCAACGTCTTCCGTGCATACTCAGACACCTGCCAACCGCCTGCAAGAACCCACAAAAGGTCAGAAAGG
GGTAAAAACTCCAGATCAATTGATACGACAGATGCCGTACCGTGGCCATCCAGCACAGCTGCAAACACGTCGCCCGAGTCGGTCGTCTCCACCGCGTACT
TGTCCTCGATAGGGAAGTTGGCCTTGTACGACGCGCTGCTGAGTCGCGTGGCACGAGACTTGGCAATGGGAGCGAACTCTTCGCGCTCGAGGGGAACAGA
GAAGGCCCCGTCCACTTCAGTCGGCGCGTATCGGGCGTCACACTGCGCTTCTAAGTGTGTAGTGCCCACATTCGAGAGCTCTGCATGGGCAATAGCCAGC
ACTGACAGTCCGAGGCCACTCAGCAGCAGCGCCTGACGCAGATGAAACTGACAAAAGAGTGAGTTGACATAGGAGATTGTGGAGCTTCTAGAGGCTCCAT
TTTAGGCGGAGAAGCGGCAAAATGCAGAGGAAACATAGGAGAAGGAAGGTAAAGCAGTGGGTACGCACCTTGGGGCTCTGTCCACGCGCCAAGCGCGCTA
GGTTCCGTGCAGCAAACAGTCGCATGCTCGCCGTCTGCCCTGCTCAATGAAGGAGGCACTCAAGGGGAGGCCGGTGATTGGACAAAACTAGATTGTTGTG
ACTTTGAAGTAACCAATCAGCCAAGTTGAAGCGGAGAGCCCTAATAAGCTGCGGCAACGGAATCGAACTCCTTAATAGCAACGGATTCTAGCTTTAACGT
TCACTCATAGTTGAATCCGCTACGTCACACATGGAAAGTGGAACACTATTGCTGCGTGTGCAGTTGCGGCCAAGTGGAACGGGAGAATAACAGACTCGCG
AAACGCTTGGCAGCGCTGTCCACTACAGCTCGATGGGCGCGTGAACTGACGACCATGAAGGCGTTTCGAGCGCAGCGATCGTGCTGGCCGACTGCAAATA
GGCCCTAGATGAGTGGATGGATGGCCATTCATGTTGTCAGTCCTTCATGAACGATGCGTGAAGCGAAATACGACTGACCATTAGCGTCGAGCTGTGCTCT
ATGTGGTCAACTCAATACGAGGACGCGTTGGCCACTATGCAGCACGTGTGTATGTTATTGTAGCTCGATCGTCTGAAAGCAAGCGTTTCGGTCGCCCCGA
CTCAAGCATAGGAAAAAGAAGCTATGAAAGTTATGCTCCGTGCTTTCTGCTAATGAGGAACGCTCTGCCCTGAGGATAGGTTCATGTACGATGCGCAATA
GCTCTCTTCCGGGGATTTCGTCCTGGCCAGGAGGCCTGGGCAACGCCCGGAACCGCGATCTCCGACGAGCAAAAATGGAGGTCGCGAGCGTTGGGCGGCT
CAGTCGAAAAATAACAACTGCTGCAAGCCAGAAAATGTGCGTGAGCGCTTTCTTGCGTCTGCAGCACCACCGACTCCTTCTTGCCCCGCTCGAAGAAACA
CAAAGCCACGTCGAGACGTTTCGCTCGGTCGCCACGTTGCCTGGGCGCCATTAATCGTTTCGCCCACGCTAGACAAGCGCTTCAACGCCGGCACACTCAA
TACGGATCGCTAGTTAGCATCGCCATTTCGGGACATCAGACGCCGATAAGATGGCGGCCGAAAACTTCTTCGTGCTGCACCTCGTAGACTCGGTCGACTG
GGTCGCCGACCACGAACGCAGTCTGTGCTACGTCTGCACGAGACCCTTTGGTACCTTCCGTCGCAAACACCACTGCCGCATGGTAAGTCTACACGACCCG
TATTGTCAGATGCATTCCCAGGTTGCTAACGCGTGACTGGTGCTATTGTCGCAGTGCGGCGAGGTTGTTTGCAAGAACTGCACGCTCTACAAGGACGCGA
ACGTGGATCCGACGATCGGCCCCACTCGCGTGCGTGTGTGCATGTCCTGCGTGATCAACAGCTCAAACCAGCGCTCGGGACAAGCACCCGGTGCTCTGTC
ACCGCACCACAGCGTGACGTCGGAAGCGTCTCGCGAGTGGCTGCAGAGCCACTTGCACTCACCAGCATCAGGTCCATCGTCTGAGCCTGACTGCGAAGAG
CTGCTTCGGTCATTGACACCGAAACAACGACAGCGCCTTGAGCTCAAAGACGACCACTTCAATGCAGAAGGCGAGTCCAACAAGATCAAGGTTGAGGAGC
ACAGCTATGAAACATCACCCGAGTGGACCCACCCGTGGCCTCGACCGCCTATGGGCGCTGATGAAGAAGCTCGGCTACGAGCATTGCATGCACTCAATGT
ATTGGATTCGGATTCAGAGAAGCCCTTCGACATGATCTGCGATTTAGCCAAGGCACGATTGTCGTGCCCCATGGCTGCAGTGAGCTTTTTGGATGAGCAC
AGACAATGGTTTAAGGCTAGCGCGGGACTAGCACACAAGATGATCCCGCGCAAGATCGCATTCTGCGCCTACACTGTTTTCGTACGTGAACCGATGGTTG
TGCTGGACACGCTTCAGGATTCTCGATTCCGTAAGAATCCGCTCGTCTCGGGTGCTGCTGGCGTACGATTCTACGCGGCTGCACCGATCATCGACCCGAA
CTCTGGCTATGCCGTCGGGAGTGTCTTCGTCCTGGACACTCGTCCCCGAGAAGCATGCGATATCTCTATTCTGGAACGACTTGCATTGGCAGCAGGCGAA
AACCTCCCGGGGATTGCAAGTGTCGAGACCAACAATCAACAAGACAATTGTGAGGAGTCTGCAAGGTACCCGGACAGTGAGAAAACACACCAAGTTGCTC
ATCTAGTTCACGTTTCCGCTGAGAATGGGCTCCAAAGATTTGATCGGAGTAAGATTGGGGTGCCCGGTTCTCCAGTAACGTCAACTACGGCATCGTCAAT
GTCCTCGGTCGGGTCGTCCTCAACCCCATCGATGTCTCCATCCAAGGTGAACAATAACGAGAGCCAGGAATATGAATCGTCAATGGCCATGACACAGCTA
TCCATGGGGACAACAACAACAGGCGAGCAGATGGAGGTGCTTCTCATGCGCTTGCTGACTCAAAATACTGAGACACAGCAGCAACTGGCGGTGCAGCAGA
TTTCGCTCTCCACGAAACTGGGAGAGCATACCAACCAGATCAACAAGCTCATGTCCGACTTTGCTCGAATGGAGGCAAAGGTCGAAGCTAAGGTCGACGG
CAAGACTAGATGAGCTGCGACGAAGTCTGAGGATGTGCAAAATTGAGTCACTCCTTGAGTGCGTGGTGGCGCAGCCCGATGCGAACATCATAGTGTGTGC
TGGTCTCTCGATCATTGCCGGCGAGCACGAGAGACCCGTTATTGTCAGTAACGTAGCCGGTGATATCTATTCAACGAGCTCACAGCGGATTCGTATTTCC
AGAGCAAGCAAGCAGGCACCGTAAGTCAGCTTATGCTTGTACAACACCACTTTCAATCGAGATAATTTATGTAGCAGTCATGAAGCTGACTATAGCCACA
CCTGTCATTGAGTTTGAGGAGAATACAACCGTCTTCCATGTGCATTTTTATGGGTTTTATGAAGACGACTCAAGCAAGCGCCGAGTCGATCGTCGCGATG
TTCCTCCAAGGCCAAAATTGCACACGACACAAGTCAGCAACTGTGCTTCGAAGAGGGGACAAAGCTACAGACGCGACTTGGCAGCCGGACTTCAAGCGTA
GACAGCCTTCTGCTTCTCCACCTCGGCGATGTAGGCCTTCATGGCGTCCTCGGTGGACACGCCCTTCTTGGCGTTCCAGGCGTTCCACTTGGCCTTGCCC
GTCAGGTCGAACATGCCCGGAGCAGGCGTCGTGTTATCACCGACAGTGGCCTGCTTGTAGTAGGCGTACAGAATGAGCTTCTCGTCGTTGGACTAGAGAT
GATACACATGTGTTAGTGAGTCTAGGACGATTGGGTTGGGTAAAGGACGGCTGAGCCACATACGTTTGGCTTGGTGAACGTCTTGGCGGACGCGGCAGCA
GCTTCGAACTCGGTCTTGAGGTCAGACATGGTGATGAAGTAGATGTAGAGAGGAGATGGAGTCACGCGGGGAGGAAATGGCGAATGAGATGGAGATCAAG
GTGGGGGGATGCTATCGGTATAGGCGGGGTAATCGTCCAATACCAAGGCCAAGTGATTTGGTGACGCGACGTGGCCGAGCAGGAATCTCTGTTGTCACCT
CCATGCCGTTCCACTTGCAGCTGGCAACACCAGCATAATATCCATGCATCAGAGTTGTTACTACGCTTGGGAACGACACGTTGGTGCCTTGTCGGTAGAA
GGATGCCAACCTATGGCTTGTTCTCGTGGTATTATTGCTGCAGCAATGACAAGAACGTAGAGGGGAATCCTCGCTACATTCTTGCTTGAAAAAGCTTGCC
ATACTGTTTGTACTGCCTCCATATTGCCGTGTATGCAATGCACTGGACAAACAGCGATCGTTGACAGCACCGATGACAAGCATCACTGCAACTGCAACAT
GCTGTTCTTAAGTTGCGCCAACGATTAATCTGCAACTTCTCGTTTATTCCGTCTCCCCTGGTACATACTGTCCCCGACTGTACTCTCTCCATACATTTCC
CAAGTCACTCTAACAGCAATCTGCTGTCCAGTCAAGTCACAGCAACACAAAAATGCCGCACATGAGCAAATACTCTTCGATTGGTGGTCTCAGGTACAGT
CCGCATGGCCCTATGGACACTATTACTTGAGCCACTTCAGATCTAGCGAGTGAACGTCATACGATGGCGGAGCAGCCGGAGTTCCACGACGTGGTTGTCA
TCGGCGCTGGCGTCGCCGGTCTGCGCTGTGCCAGCCAGTTGATACACGTCCAGGGCGTCAATGACGTGCTGGTCGTAGAGGCCTCAGAGCGCGTGGGTGG
CCGCGTGATGAACAACACGGACTTCATCCCTGGTCTCAGTATCGAAATGGGCGCCGAGTTCATGCACGGCGAGAACACGACGCTTACTCGTCTAGCAGAG
GAGTACAACATCGGTATACGAGAGATCTTCACTTGGGCTCAGGTGAGGACAACGTTAATGCATGTGAACCAATGCATATTGCTACAACCGCATCGATTAA
TCAGCCACTGATTTGCTCGCAAGAGCATTGAGATAATCTTCTGGCCTTCATACGAATGCAAAAGTGAACATTCGACCATGCTTCCTTAATTAGCATCTCC
AGGGCGAGCGATGTAGTCTCCTTCAGGAGGCTCGTTGCTCTTCTACGTGCATTCGGTGGCACAGTTCTTGTGTTGCTGAGTCTTGTACGTGTCCACCCGG
GAGAAGTCAGTCTGGATTCATACATTTCATTCCAAATATGTATTGTAGTTATAGTTTCATTGATATGCTCACGATCCATTGGATTTTGCGTGATAGGGCG
ATGGTGGTCCGACCGACCCCGCTCCGGATGGAGGCATCGGGTATTACTACATCGGTGATCAAAAGCGCATGCTGAAGTACGACGATGAAGACGAGGAATT
CGTCAAGTTTAACTCGTCGGTGGCCGAATTGAGCGATCTGGAAAATATTGACCAGATCCCGCAGGAGAAGTCTATGCGAGATTACTTCAACGAGGTTGGG
TTGTCTCCGTCCATGATGAAGCTTTGTGAGTCTGGATACGCTAACACTGCCGGTGGACCGCTGGAGGATATTTCGATGCGCACTACATGCCGCTACGAGA
AGCAGTGGATTGAACTGGAGGACGAAGGCGACTTCCGTGTTGTGCAGAGCTTCATGCGCTTCGTTGAGCACTTTGCTGATGGCGTGACAACTCGATTCAA
ATGGCCAGTTGCTAGCGTCGACTATTCCCACAGCGACCGCATCCTGGTAACCAGCACGTCAGGCAAACAGCTCTCGTGCCGCAAGTTGGTTGTGACTGTG
TCTACTGCTGTATTTTCAAAGATTGCCTATACTCCTTCACTTCCTCAGGAGAAGATTGACGCCGTGGCATCCTTCGACATGCGCCGCGCTGGTAAAGTGC
TGCTACACATGTCTGGTCGCTTCTGGCCTGAAAATGCGCACGGTGTCGTGTGCTCGGATTGTTTCTTGCCCGAGTTTTGGTTTAACAGCACGCAAGGTAT
TGGCCACTTAAAGCCCAACGGTGATAAGCTGTGTGCTGAGGAGGAAATCAACAAGCTCGCGGATAGTGAGACACAGTACTTAATCACCGGTTACGCTGGT
GCATTGTACGCGGATAGATTCGTAGGTATGGAGCATGAGAAGATCATTGAGGGCTTCCTCGACCAGCTCGATCTGATCTACGGCACTGTGGATGAGCCGT
CTCCGGCGCACAAGTACTTTGTCAAGGGTATGTATAAGGATTTCGGGGATGAGCCGTGGATTGGTGGCGGATACGCTTTCCCACGAGTAGGTCAATCGGA
TTCGGCCTCCTATGACCTGGCCGCGCCAGTAGACGATCGCATTTTCTTTGCTGGAGAAGCCACAGCATTTGAACAACCTGGTATGTCAGTCCACGCAGCA
GTTGACACTGGTACTCGTGCGTCTGCGCAGGTCGCGCATGCACTCCAAGAGCTTTAGATTTGCAGTTGCTCGCTACAGGAATGCAGAGTACGGACTTTTC
AATACAATGATATTGGAATATTTGCACACCTCAACGTGTTACCTTGCTCTCTCACAGCACTGACGCACAAGACACCTCACAGTCAGGACATTTTACCTGA
TGACACACCTAGAAGCCAAGAGCATCTCAAATGGACCCAGTCGATTGAACCTATTTATTAGTTTTGGTATGGTGGCCCGTGTATCGTACGCTCAAACTTT
GGTCTTGGTCATTACGCTGTCATGGCAGCAGGTCTTGAACTCAAATGGCGCTTGGTAAACGATCCGCTGGTGTCGTTGCGCCGCAAAATATTTATATAAG
TAGTGTAGGCGGGCAGGAAGCGCAAGAGCATATTGATGGCTGCTTTGTTGGTGCCACACCTGTTTGAGCCGCTGGTACTGCAGCGGGGTGGTCTCCAGAG
CTTTCTGTTCAATAGTAGTTGTTCGCCTGCTCCTCGCGCTCCAGCCGACTCAAAACGTGCTTCCCGAACGTGAAGCGCTTCAAATAGTCCTCGTTGTGTC
GAATAATACATACAATGCGATGGCGGTCGTGGTCATCCGCGCGCTCCAGCAATTTCTGCACAACGTAGTTGCCGTACATGTGTTTCATCATTGGTAGTAG
TGCGCAAGCCGCACCACTTTCGTCACACTGAAGGATAAAATCAACAATCTGGCTGATCTCCTCCTTTGTCGCATGCTCCAAGCAGGATTCCACAACATTG
CTGGCGTACTTGTGTTGACTCCAGCGTGCAATCTCGGGAAGCACTGCTTGCATGACGATGTTGCGTTGGTCCTGTTCACCGTGGCTGATGACGTGCTGCA
CGACGTAGTTGCCGAACTGGTCCTTGACAAGGTCGCGGCACTTAAAGATGATCTCATCCAGCAGTGGACGAATCTGGTTCGGCGCGCAGTGTTCGAGTAC
GCGCTGAATCACACGGCACCCATACGAATGCGTGGAGAGCGCAGCGGCGTGGCCGACGAAGCTGTCGATAATGAACTGAATGTCCTCACCCGTCACGAAA
CGTTGAGTGCCCAGTCCGTTACATTCGGCCGCTCTCTTCCAAGATGCCGCCTCGATACACTTCTGCAGCACGTGATTGCCGTTCTGGTCAACGACGCACT
TCATCACGTGGCCCTTCAACTGTCGAATCAATTCGAGCTGCTCTTCGACTTGAGTCACCTCCAGCGCACGCTGGATCACGCGGCATCCATACACCTGCAG
GGCCAGGCTGATCATGTTACTTGTCATCAACTCCACCAGCAATTGCTGCTGTTCCAGAGACCCATACTCGAGAAATTTCTGGATCACGTAGTTTCCAAAC
ACATCCGTCATAAGTAGTAGCGAGTTTGGGAAGATCTCGTTGAATGCGTCCGCTTTCACGCGCTCATCGGCCTTCTCCAACTTCTGCTGAATAAAACGGG
AGCCGGTCTGATCTTTCGCGAAGATGAAGAGGTGCCCTTTGATGGCGGACAATCCCCATTTCTCCGACTTCGGTGCCGAGTTGAACTCTTCCAGAAGGCT
GTTGGACGAGTACGAGTGAGCTACTGGGTGAAAGTACTCGAAATCACTTCGTCGAAGACCTCCGACCTTGGGTCTGTGCAGCATCTGCGGACGAGGCATG
TAGCCTCCGAAATCATGGCGCTCATACAGTGGGTGATCAATCAGTGGATACGACGGGCGGGCTTTGAACATCTTGTCGGCGGATTTCATACTGCGGTACT
CTCCAGCATAGCTGACCGGGTAACTTGGCATAGCTAAACTGTGACCAGGGTGGGCATGCGCAAAATCCGAAGGCACGAAGCCAAAAGGAGACGACGGGAA
CGAGTACACGTCCTCATTTGTAGCCCAGCGCGGTTTGCCAGTACTCATCATGACCGGATAGCCTTGAACACCTTGGGAATTCATGGCGTAGGGTGATGGA
TAACCTTGCGCCATAGCTCCATTGTATGACTCACCAAAAGGAGGCTCGCTGGTGCTTCTACCGAACGTGTGTCGGTGGCCATTCATGCCAGCAAGTCTAG
AACCATTGCCGTGCTGTGGCACCCGAGATAAATCTCCAAAGTCGTGGCCAGATCGGCGTCCAGAATCGTAAGGCAAAGCCGAGCGATAGCTATCGAGCCT
CAAATGCCCCATCCCTTCAGTGATGCCAAACATCGATTGAGACTGCTGATCCCTTTTATCAAATGATGGTCTGCGAGCAGTCAAACCTCCGTCCTCGAAG
TGCCCATACTCAGGAGATGGTGTGCGGGGGAAGTCCTCCTGAATACGGTCGATCAACGACATTCCTGGCGGCACTCGACACCCCACACCATTGCTGTCAC
CACGTGACGATCTTGCAGGGATGGTCGTCGATGCGCTTGAGCGCGTGAAATCTTGCTTGTCAGGCGAAGTGGTGGGGCTCACTGTCGAGTTGAAGTCGCC
GTTTTCAAAGTCATTGTGAGGGTTCTTCCAGATATCCACCGAGTGGGGTTCACTGCTTCGATCTAAAGCACTCTCTCCATCTCGGAGCTGCTAGTAACAA
GTACGAATGACAATTCAGTCAGAACAATTTTTGCACAAGGCCAAACGAGTTGAATCCAGCAAACATACCAGATTGAGAGACAAGCCATTCGACTCGGACT
CCTGATTATCCGTAGGTTGACCATCCTGCGCAAGTGAGCAAATCAACCCAATAGATTAGAACCGAAGCCCACGCCATATTCAGCAGTTAGGAGGAAGGAA
GTACCTTAGTCGACAACTTCTGTGTCGATCCCCATGACGTCGATAGCTCTCCAACGATCTCAGATGAGACGTTGAGCTGGTTCTCGTCTTCCTTCTGGTT
GTCTACAATCGCCTCACCTTCATCTGACTCGCTCGGTGGCGTGGTCTGAGCGCTGTGCACGGAGCGCGAATCCGTCTTAGACTGCAGTCGCGGGGCACGC
AGCGCGAAGCTCGCCGGGCGTTCGCTCAGAGCCTGGGAGGCGGAGAAGAGTAGCGACGAGCGAGATTTTAGTCCTTCCGACGACCAAAGCGAGTCTGACT
GGTATCTGGCAGGGTCCTGTAGCTTCACGCGCACCGGTTCGACGGGGTTGTCGTGATGGACGGGCTTCTCCAGTGCCGCGATGCTCGATCCGGCGTGGCT
GACGGCGCGCTGCGGCGGCGCAATGGAGGAGGGGGAGCCGCCACTGACGCTCTTGGCGGGGCTCATCGAGTCGCTGTGACCCATGGCACGGAGCAGGCGA
GCGGTTGCTAGGCGTCGAGTGCCGCTGAAACGCCGCGAGGCCGGCGGTCGTCCACTTGCGCGGGAGGCGGCAAATTGGAGAATGAAGCCGCTGTGGACGC
GGGCGGTGGGGGGTTATTTCGAAACGGGCCCTTCTGTGACAGGTTGCCTCGATTTCACTTAAAGCGAAAGGGCCGGGCGGAAACCTTCAGTGACGAGGGC
AACTCGCGCTGAAGACCATCTCGAATTTTCAACGACCGCGCGGGTCTGAGATGGCGGGTGTGTAACAAGCAACGCGAAACCGCGCGCGCGAGCGGCTCCG
TTCGCTCTAGATGGCGTCGCCGTGGTGGTCTGCTCGCATCGGAATTTTCGGTCGCGCATCGGCTCGCTGCCTTTCACGGAAAAAGCCCGAGCACGCACGT
GTCGAGGCGCGTGATGTGACTTGACCGCAGTGGTTTCCCGCTGGGGTTTCCGCGGGTCGGAAGAAAGGGTGGAAGCGCGAGCGTTATGCTAACGGCAAGC
AGTGGCGAAGCGGCGCGGGACAGCCTGGGATCGTCGACGCGCGCCCAGAAAGGGCGGCGACCATCACTCCGCACGGCAACTTGCCGCCAGCTGTTCGTGG
CATTCGGCAACATCACATCTTGGTGACAGGCCTCACAACGCGGCGGCTACGACTGCTCGCCGCGGAACGCCAGGCGCGCGAACGTCGAAGCAAGCTGGCT
AGCTAGCGGAAGTCACAGACTGCATTGCCTCGCGGGTCAGATCGAAGCTCAAGGCAACAAACTACTGGCGTGCGTGCGTGCGGGGTGCACCGCGATGGCT
CCCTCTCGCGTTAGCACCGTCGCCGTGTCGCTTTACACATAGGAAACATTGCTGAGCCCGTTGTTGCGGATACCCTCTCGTTCAACAAGGACTAACTGCT
GTATTTGCTCTCCATGGTGGTGCTAAAGCGAGTGTGCGAGTAGTATACAGCGCTCGGAGCGTCCACACGTTGCGCGATCCCTGTCGCAATATCAGCTGCT
GACAGCTTCCTCGAAGGCGCGTCCTGCGGCTGTGGCCTAGCGGAGACACCGGCGTTGTCTCTCGACTCGAGAGAGCCAGCACCCAACGTTGAAGTGGCAG
GGGACACCTGCGCGTCGATCGCTGCTTACGAGCTCTTGGGCTTCAATGCCAGGAGCGCAACAGCAGCCACGCCCGCGGTCACCACCGAGGCCGTGGCCAG
CGCGCGCGTGCTCAAATACCACGGCTCGTCCTCGGTCGCTGCCACCTGCTGACGTTGCGTCTTGGTCTTGCGCGTGAAGATCGACTTTTCCTCGCTGCCG
CTCTTTCTAGTCGTCGTCTTGGTGGTCGTCGCAGTTTTGATGGTCGACGCCGACGCGTCGAGGTTGTCGAAGATGCCGCCCCAGGCCTTCTTCTCGTCGC
GCTTCTGCTTGTCCACCAGCTTGCTCACCTTGTCGAGCAGCGTGCGGCACGATTTGTCTCTAGGGTTCAGCTTTACCGCCAGCAGCAGATCTTGCTTGGC
GTCCGCGTACTTCTCAAGCTTCACGCACGCCTGGGCGCGGCGGAAACGCGCCTTAGACGGCCAATCCTCGAACATGAGCTGCTCGGATAAGCCCAAACGC
CCCATCCAGGTGACAACATTGCCCTCACGGTTTTCGACTAGAACTGTGAGAATGCTCAAGGCGTTCGTGCACGCGATCTCGGCGTCCATGTACATGTTCA
ATTTCAATTTGCACGCACCAATGTTGAGATGGCAGCGAATCATGGTCTGAATGATAGTGGCCTTCTCCTTGTGAGTGGCGTTGTCCTGGTCCACGCGCTG
GAGGAAGCCCAGTGAGCGCAGGTAGCTGTACACAGCGTCCTGCAGCTTGCCTTCGCGGAATTCCTCGTTACCTGCGTCGGCGAGCTTAATGGCCTCGTTC
AGCAGGTCCTTGGTCGACATCTCAGAGATGTCCTTTACCGGTAGCTTCACATCCTTACGCTGCATGAACATACGAGCGTAGCCTGTTTTAACGATCAAGA
CATCGTCGTGGGGACGAATTTCCTCCAACACACCATGACCGTACGGGGTTGCCACCTTCATGTGCATCCGAAGGTGCGGCTCATCAGGTTCTTCCTTCAC
GACGTTCTGGCGCAAGTAGGCAATAGTGTGGTTCTTCGATGCTACATCAGTGTCCATTTGCACCACGTACATCTTGGTCTCTGGTCGGAATGATACCACA
ACGCCTCGCCCAAACGGAGTTACAATACGCGTCTTGTCCGCCAGAGGTGCCACACTTACAGCAGCGGGATGGTGTGCATCAATGTGGAATTTGTTGCCAG
GCAGGTAAAGCGCAGCTCGTGCTGTCTCCTTGCCAAATGCTGCAGGATGTCTCACAGGAGAATTCACTAGTCTCGCCGTGGTCTTAAAACGCTCAATATC
GTCGTCATTTTCACGTTTCTTCTGTCGTAGTTGAGTCACCTGATGCTCATAACGTTCGCGCACCGAGTACTCGAACGTGACGCGCAACAGCAGCTTACCA
GTAACACCTGTAGTCGCTGCAGACGCCGGAGCCTTCAAGTCAAACCACCTCTCGTGAGGCATCTGGTCTTCATAGTCGGAACTGAGCAGCTCCAGCTCTC
CAAGTACCACGTCAGCAATGACCTCAGCACTGCAACTCAACAAGACCTTGATACCGAACTTCAGGGTCTTGGCACCTACATACACCAATGACTCCTGCCA
ACTAGCAGTTGCGTTGTCCACTGCTTGTACGCTGTTAGTACGAAGGTGTTTTTTCGTGGTCTTTTCGAATGCCGACAGCGGCGTCACCTGCGTGGACACG
TACAGCTCCGGCTGTGCATTGCCGCTCGCTGCTTGCACCGCCGCATTCTTGTCCAGCGTCAGGGCCTTAGCTGCCAGAACCTCAATGGTTACGCAACCAG
CAGCCTTGCCAGTCTTGGCATCCACATCCACACCATTCTTGTTTTGTTTACCTGCTGCGGATGCTGCAGCTACCTCCTCGGCGTGCTGCAGTTCGTGCTC
TAGCTGCACGGACAGCAGTTCCAGCGGCGAAAGCGCCACCTTCTCCCACATGAGAGAGTTGCCAAGCCCTACGGACGACACCGGCGAGTCACTTAGTGAT
TGCACGTCGCTCATGTCTTTCTTGGTATTATACGTGCAAGGCCAGTAGCACCGACAATTGGCTGGCAAGTTCGATGTGTGATGGATATGAAGTTGTCGCG
GTTCCGACCCGGTTCGATTCTGATCCTAACCGGTCCCATCTGATTCAAGCAACACTCATGCAACATTCGCCTGATAATGCCAAAAATATAGTGTCGCATA
ACGCAATTCGCTGGCAAGATGCGGATCCAGGCCGAGGCTGTGGCGGGGTCTCGCGCCAGTTCCGCGGACGACGCGCGCGTGATTCGTGTAGACCGCAAGT
CACTCTTGGCGCGTGCAAAGCGTCGACGGCGGCGTGAAGAGCGCGAGGAGCGTGAAGCGCGGCGTTTGGGCAATCGTCGGCGATCGTCGTGGCTGTTCGG
CGGCACAAAGAGACCGCATGAAGACGCTGTGGAGCCGCCATCGCCCTTCGCCAGTAATGTGGTAGTGAGTGCCAAGTACAGCGCCTGGAACTTCGTGCCA
CGCGTGCTGATCGCGCAGTTGCAGAGACCCTCGAACATATATTTCCTGTTCATTGCAGTACTCCAGACCATACGAGAAGTCAGTAACACAAGTGGTATTC
CGACGATTTTGCTACCGCTAGCAGTGGTATTTGTATGTAGTGCTATTAAAGAGGCGCTTGAGGATCGAGAGCGACACCGAGCTGATCGTGTGGCCAATAG
TCGACCAGTGCTGACGCTGACTCCATTAGGCAGGTGGGAGCAGAGGCAATGGGGAGACCTACACGTCGGAGATATCGTTAAAGTGATGAATGACCAGACT
ATCCCGGCGGATTTGTTCCTGCTGTCAGCGGAAGCGGTGGAACATGACGATGATAATGGTGGAGAACGACAAGTTCAAGAAACTACGAACCCAAGAGAAT
TGCAGGACCAGGGTGACTTGGAAGAAGGTAAAGTAGAATCTGCAACAGAAACGTCGGAGCTTCTGGTAGATATGGGAGATGAGCAGGTATCTGGAACTTC
TCCATCTCCGAAGCAAGAGACTGCGGAGTCTAATCTGGCTTACATCGAAACGAAGTCACTGGATGGAGAGACCAATCTCAAAATTCGCACGGCCATACCA
TTAGTCGCTGCACTTTGTCGCCGCTCTAACAGTCAAATCAGCACCATCGACGGTGGTGGACACAACCAGCTGCGTGGTATGATGGTGTGCGAACAGCCAA
ACAACCGAATTACCAGCTTCGAAGGTACTTTTTCGGCTGTGCTAACCCCTGCTGAAGCTCAGTCGTTAGGTGTAACTATTAGTGATCCAAGTCAGCATTC
GCACCAACCCGTCCCACTGCAGCCTTCGGTTGGACTAGTACAGACTGAAGCAAGTGGAGATGGACTCGTGCGCGTACGAATGCCAGTTACGGCAAAGCAG
ATGATGCTACGGAGTTGTGTGCTCCGTAACACGCGATCAGTCACGGGAATGGTGGTGTTCACAGGTCATGAGACCAAGGTGTTTTGCAGCAACACAGAAC
CCATTGTGAAAACGTCTTCAGTGGAGCGGCGGCTTAACCGACTCATCATCGGTATCGTATTTATTCAGCAGCTTGTTTGCTTTCTGGGTGCATTACTTGG
TGCCCATTGGATGCACACTGAAGGAGATTCGTTTTGGTACCTTCTCAGTGCGAATGAACGACGGCATCACCATTTAACTGGCGCTTCAACCTCTCATCCA
CTGGCTGAGCTTGCCAAGTTGCACCTGCGTTACTTTATTATCATGCAGAACTTCGTCCCTATCTCGCTGAACGTGTCACTGGAGTTCGTCAAGTATTGGC
AGGCCTACTTCATCGAGCAGGATCTGGAAATGTACGACAAGCAGTCAAATACACCCGCCATGGTGCGTTCGTCAGCCCTGAATGAAGATCTCGGTCGCGT
CCATCATGTCTTCACGGACAAGACTGGTACACTCACGATGAATCTTATGCTTTTTCGTTACTGCATGGTGGGAGGGAAGCATTACGGTGGACTCATGCAG
GAAAAGAATATGGAGGCAGACGCTCCTAGCGAAACTTCATCCTCTTTGGGCTCTGATTCCAAGGATGGACCACGATTTGTTGACTTTGATCCAACAGAAC
TCTTTGCTGATATCCAGGCGGGAGGCACGCAGGCAGAGACTCTCCGCCACTTTTTACGACACTTAGCACTGTGTCATACGCTGATTCCCACCAAATCTCT
CACTGAAATGTGCTGTACGCCGTTCCCGGAGTATTCAGCATCATCACCCGACGAGCAGGCCTTGGTGTCTGCAGCAGCATTCTGTAACGTGCGGTTTGTC
CACAGGACTCCCACTGCCATGATGCTCTTGGAGTCCGGTTGGGCAGCACCTTGTACATACAAATTGCTTAACGTATTGGAGTTTGACAGCGACCGTAAGC
GCATGACGGTGATCGTCGAGACCCCTGACGGCACGATAGAACTCCTTTGCAAGGGTGCAGACAATGTCATTTTTGAGCGTCTTGCTGCCGATCAAGCAAC
GTTACCTAGTGGTATGTCCTACGAGCAAGCTTCGGACCAGCTTACACTGTATGCAAAAGCTGGTATGCGTACGCTTTGCCTCGCGTACAAAACTATTGAC
CGACTCGAGTATGAAGATTGGAACGCCCGTTATGCACAGGCGCATAGCTCCTTGGAGGAATTAGTGAAGCGGCGTCAAGGTCATACGAACGCGATTGACC
CGCTAATGAACGAGATCGAGCGTGATCTGGTTCTTCTTGGTGTCACCGCTGTCCAAGATAAACTGCAGGTTGGTGTGCCTGCGACGCTGCGTCTATTGCA
AGAGACGAATATTAAAGTTTGGACTCTTACCGGCGACAAAATGGAGACGGCTGTGAACATTGGATACGCCTGCGCATTGCTATCTCATGACATGGATGTA
CAGCAAATTGGCGGGGATGACTACACCTCAACTGCTGCGGCGCTGAAGGAATTATTACGATACAGTGATCAAGCGTCTACTGCATCTAATCTATCGCCAC
TTTGGGGCCAACTTTCGACCAATTTCTCGAGAACCAATGGAGGTAGAGGAGTGCGTCGACATTCTCGTAATGGAAGGCACCGTGGTTCACCGCAAACGGA
CAGTTTCTTGAGTATTGCGAAAACAACGATAACTAGGTTTCTCTTTGGGGCACCAGTGAAGCAAAAACGAAAACAGAAGCGGAGACGCCATCGAACACGT
CGGACATCAAGAACATCTTCAGCTTTTAGCCAAATCCCAATGTATTCATCAGTTGCAACTGATGCAGAATACGCGGATAAACTCACGTCTGATGAGGAGT
CCCTCTATGATAACGGGGTCGAAGCTGACAATGAAACAGTGTACACACCCGAATACGGATCCCTTGCAGGGAGTTCACATCGTGGTGAAAACTGCCGCAA
AGATGGAGCGACGTCACAGAAGCTAGCTCTAGTAATCGATGGACAGGCTCTGGAGTTTGCTCTTCGCCCGCAACTGCGCAGCCTGTTCTACCAAGTCACC
CAGCAGTGTGCTTCAGCTGTCATTTGCTGCCGCGTGTCTCCCAAACAGAAGGCTGACATTGTTGAGTTTGTGCGCGCATTTGATCACGACAGCGTGACAC
TTGCGATCGGTGATGGTGCGAATGACGTAGCGATGATTCAAGCAGCACATATTGGTGTTGGCATTTCCGGTCAGGAAGGAGCCCAGGCCGTGAACGCCTC
AGACTACGGACTTGCGCAATTTCGATTTCTACAGCGGCTACTCTTTGTGCATGGCCGATGGGCGTACCGAAGGGTAGCCAAACTGATGAGCTACATGCTT
TATAAGAACGTAACGTACGTGCTCACAACCTTTTGGTTTGGTTGTTTCTGCGGGTTTTCCGGCCAACCTCTTATCCTTGATGTCGCTGCACAAAGTTTCA
ACGTGCTCTACACAAGCGTGCCGCTGGTGCTCTTCGCTGTATTTGACCAAGATATATCCTCGACAAGTGCGGCTAAGTATCCGTACCTGTATGCGCTTGG
CCAGAAAAATATTCTGCTCGCACGTCGTGTATTTTGGCCTTGGATATTCAACGGAGTGTGGCACTCCATCGTCATCTTTTTCGTTTCTGCTTGGGCTTTT
GAGGGCTTTGGCTTAAGCATTCGGAGTTTTCCAGTCGTTGCTACCGAGACAGGAAAAAGTGGTGGACTTGTCACGTTGGGATTTGTGGTGTTCACGAATC
TAGTAATTGTTGTGAACTTGAAGCTGTGTCTCGAGACGTTCCTGCTTACCTGGCAATTTCTACTTACAGTGACCATCTCTATATTGCTGTGGTTCGCTGT
TGGTTCCTTCATTTCGCTTCCAAGCACTGGGTTCCCGCAAGCCGCTGGTGAGATGGAATACCTTCAAGAGTTGCCTACATTCTGGTTCGTGTGCCTCCTG
GTGATGTCGTTGAGCCTTTTGCGTGACTGCCTCTGGAAAATTGTGCGGCGTTTCTCGCTCCCATCCACGTATCATATTATCCAGGAGCGCGAGCTCATGG
GTTTGCCGAATTCACCTCGCGGCATGCTTCGGGAGCATCAACGATCTATGTCAAATACAGCGTGGTCGGATGAACCAGCTGCCGTTGTCGACTACAAAAA
GCTTTTTAGCAATATGCCGCGTGTGGAAAGCCCTGAAGAAACGCTGATGCGTTCCTCTCCGCTTGGCGAGAGGTTAATCGCGTCCTCTTTCTCCAGTTCG
TCCAGTGGTGGAGACACCGTTGACCCGGATCATATGGCAAGATTCAAAAACCGAGAGAAAACGCGTAATATTCGCATTCGCGGATCATTTCATTCTACAG
GTAGCTTTGACAGCTTTGGCGCAGGTTTGAAACCATCCTTCCTCGAAGCTCCCGGATCAGTTGCAGCCACAATCACAGCGCATGCAGCACTCGGATCTCG
TTCGTCATCTTTTGGCTCGTATCATGGCTACGCGTTTTCGGAAGACGAGAATGTGGACAGTGACGTGGAGGCAGCGTCTTCCAGCACATCCCGAGGTGAC
TATGCGCAAGCGAAGTCCACGTTTGGAGTGCATGCCAAGAAGGTTCTGAAATCAGTTCGAGGTAGGAAGAATGCATAAATGTTTTTAATGTCAATATGTT
GATCATGTTTCAGTGAAGCATGAAGACACCGTTGTTTGTATGATGCTGTCAGCTTTCTCAACGAGAAACGAATGGGGCGCTATATGTTGATCGCACTCGA
GAGCTTCATGCACGGCATGCAGATATCTACGTTCACCGTAGGAGCGGCGTGGAATAATCACTGACTTGTTGTGCTTCTCAACAGCACAGCGGTATGGCCG
TGCAATACGCACTGGTTGGAAATGGTCGCTGACAACCTGTTTGTACGGGCGAGCATACACGACTCGTTCAGGTGGAGATGGCGGGGCTGAAGCTAACTCT
GGAGTAAAGATTGAGGGTACAATGGTTTTCGGTGCTTCTGTTGTCAACCGTAGCAGGAGAATGCAATTGAACGTGTGTTCCTGCACAAGGAAACAGAGGA
TGAGGTAATAAAGAGAGATGTCAACGAACTCGTTTGTTTACCTGCTCCCAGCGACTATCACCGTCGTCATATTCAATTTTCAGAGCTGCGGGTGAAGATT
GAGTGGAACCGACTACGCCGTTATACCATTCCCTTTCGTCGGGCCAATATACCATCACGCTACGCCCTACCATGTCCAGCGCACTCAGCGGCAAAAGCTG
CTGCAATTGATCATACTGTGCGCTAGTAGCAGGGAGCGGACGAGTGTTTGAAGGACACTATAGAAACAGCACTTCAGACCACTTGATCAAATCGCTGAAC
GCAAACTCACCTCCCACTGCTGTTCTCCATCGTCGTAGTGCACCAAGTAGCGTGGATCATTTCCCTCCTCGATGCATTGAATTTCACCATCGAACCACTC
GTTCTCATCTCTCCAGAAGACCTGCACACGTGTTTCGACACTCAGTAAAGTAAACCCCGTCGAATTCGACGCCGCAACACTCGATGTCTCGTTGTCCGAC
TCGAATGAGTCCGAGTAATCGTCGAAATCATCGTTGTCGTATTGCTCCTCGGACACAGCGGAGTCAACAGAGGTGGACGCCTCAAAATCAGTACTGCATT
CATTGCTACTGCGACTGTTAACCATGGCGCCGCCACACTAGCAAACTCGGCGTCTTCTCACATCCCCCGTTACGAAAACTGCCTGCAGCAACGTCCGTCC
TGGCAGTGATATATTAGCCATCTGGCGTGACGCGTCAAGCGTAGCACACTTCAAAACTCGCAGGTCCACTTCAACGTGTTGCATACTTGTTGCCGTTTTC
GTCTCGTCGCTGACGGATTACCAGTTTGGATGGGCGACACACAGCCGTGCAAACTCGCATCTCGATGCCCTGTGCACTTTGTGTTCGGAGCACTGGTGCG
GTGCCAACAGCGGAGACATCACCCCTACAGGACTTCGACAATGCATTGGTGTGGTCTCAGCGACATGTGCTGCGGGTTTCAATAGCGGCGACCTTGGTCA
TCTTCTGTGGTGGGGTGGACCTACAGGAGGTCTTATCCACCATAGCCGGAACATGATACCAGACCAACTGCAACAAGCTGCCGCGCGATAACGAGTTCGT
CCAAGCAGTGAGCGGCATGTCGTCTATGCTGCCGTCGTTGGCATTTCGAGCGGGGTCGGAAAGCAGATCGTCACGTTGCCAACGCCGAATCTCGGATAAA
CAAACTTGAGACGAATCTTCTGCGCGTCCCATCAAGGGCACGATTTTTCATGCAAGTGTCGCTCTGCCAATTCTGGCTTTGGGGTAAGTCGCCGCCGGCA
GAGGTCATTCATGATGATCTGCAGCCCCAAGCAACCGCCCATGCATATGTAGAGCAGCGAACATTCTCGGCGCAGATGAAATTATGCGGTTCATTAACCG
GACCGGTTAGGGTTCTGAACACAACCCGCGGTAATTGGTCCAAATAACGAGGACACGACGTCAGGTGATTGGATGAAGTCCTCTCCTATCGATCTGGTTG
GCTAAAACATACCCCAAATCGCTATTGTGGCCAGAGAGTTGGCTATCTCAGCACATAGCCGGGACCATGCGGCAAACCCAAAACCCGGTTTTTGGTCGGT
TGCTTTCGATCAGTAGAGAATTTGCGCTGTAGGAGAGTAGTGTCAAACCAGAAAGAAGGAGCAGGTGCGGAATCAGAACCAAGTTGCCTTTGCGGCTCAA
ATTTGACTGCAATAGGGAGCGCAGCGACTAACGACTAACGACTGTGTGCTTGTGTCTTGTTTCGTGTGTTGCTTTACCTTTTGCAGTAGTGCATTTGTCG
CATTAAACCTATTTCCAAGAAGAGTGAGTTAGTTCTTCACCCAACCACACAAAACAAGTTGCTGAGCGAACGCACACGCCAAAAAAGTCGTTTGTGCTCG
AGCTCCTTTTGTGCCGTTTGTCCCCCATCCCCTCATCCACACAAAGCGCAGCGAAAAGAGCTGCCTATATCCCTTCTGTGTGCCACTTGCAGCTTTGTTG
CGCTTGTGCTCTCGCAGTTTGCTGGACAGAGGAACGCTTGGCTTGCAACCCCTGATAGCCGCACGCACGCACGCACTTGGTTTGGTAGTTTTTACACGAA
CTACTGAAAGACGGCATCGTAGCGACGACAGCAGAAACCCAGGAGAGCGAGTCACACCAAGTGACAGGAGTGGGCTAACAACTGCAACACAGCAACCTAG
CCGAGCCCTCTCTTAGCAATCTTGCAATTCGAGAGAGTCAACGGAACCTAACAAATGACAGCGGAGGGCATGCGTGCCAAACGACGAACCACTTATCAAA
ACATGCACGAGATCGTCAAATTGGCCAAGAAATACTCACCTAAGCTGGTGAAGGGCTACAGCGCAGGAAACATTTCTGTAGTGGATAAGAAGAGCTGGCT
GGAAGTCTGCGATCGCAAGCACCGGTAGGTTGATTGTGTCTCTCAATGATTGCGTTATAGATGTCTTACACTAATTACCTTTATTGATGGATAGCTATGG
TGCGAATCTGCGGGCGTATTATAAAGAGTGGAAGCGTCAACCGATGGAGCCCACGAAACCGAGCTTCTGGGAGTGGCTGGATGATGAATCAATTGAAGTC
GCTGGTGTACCGAGAACGAAATTAGAGCGCGAGACAGTGTTATATTGCGACACAGCCGCTGAACGTCAGAAGTTTGCGCTCTCGGTACAGAATGGCGTGA
TTGTACATGACGCATCGCAGGAGATCGTGGAAACGGGACCGGATGGATGGATTTTTGTTTTACGTGACGGTGTTCTCTACGGCTCGCAAAAGGAGACGAA
GAAGATTCCTCGAATCCACCATACGAGCTTTGTTGGTGGAGAGTGCGTGCAGACAGCAGGCATGATGGTGATCACGGACGGGGTCATTAAAACTATTTAT
CCCCATAGCGGTCATTACCGGCCGTCCGAGTACGAACTGCTAGTGTTGCTGCGCTTTCTCGTGAACAACGGTGTAGACTTGAGCGACGTAGACGTCGATG
TGCAGCGAATTCAAAAGGTGTTCCGGGACTCAATAAACGGTGCACTTATAAAAAAGCTGGACAACGCGCATTTCTGGAATGCGTACCGTGTATGGTACTT
TTTGGAGGAGAAGCATCTCGCGTGGAAGATTGGGCTCTTTGACGAGCTTGTAGAAACGGTCGGCCAAAAGACAGACATGCACGTGGCGCTCGAACGATCG
GAAATATTGGAGGACAATGTTATGGAGGAGATGAACGATGAATCGTCCGAGATTACGTTTAAGGATGGCGGATCTCATGCGCTCTCCCTCTTACACCCCG
CGTATGGTGCTCCAACGTTTGATGATGCGACCAAGCAACTAGCTACCAGCGAGCTGCAGCCGTGAATCGCTTGGCCGTGGTCATCCAAGGAGGTTTTGCT
TTCTCAAGCCAAGTCATGGCCACCTCCGCTCCAAGTTGGCAGCGGATACAACACACATCAAGCAAAGTATAATGTAATCTAGTGACCAGAGACATGGAGG
GGCTCTCTGGTGTATTCGTAGTTAGCTGATCGGTAGTAGCAACAGGGAATACGAAGACGAAGAAGCAGGAGAAGTCATTATTGGAGCGCATCCAGCATTC
GTGATGGCTGCAGTGGTGCGCTTTATTTTTATTTTATGCGTTTCATGCTACTTTGTGCTGGTGTGTTCGTCGATGGAGGAGTTATTGGGGAGTGCTGTGT
CGTTAGTACAGGTGAACAGACGTGGAGTTCTCAAGGCGATGTCAGAACAAAGTAGCAATGTAAAAAGCTTTAATGGTAGTGCTAGGACAAGCGGTGTTGT
TGCTGCGCTTGATGGTGCCCCAGTACTCAGCCATATCCACGTATCATGCTACGTCACTGCTGCTAATCGCGCGTCGCCAGTGTTTGAGGTCGCCCCGCAG
TCTAACTGTGTGCGAGTGGTGAACAAACCCACAAGCGATTCATCATCGGGAACTCCTGTGGGTGATGTAAAAAATACTAGGATGATGTCGACTGTTTCTT
CTAGTGGCGATATTGCGGGAGCTGAGTGGAATTTCCATACCGTGTTTTCGTCAACCTCGCCTTCACATTCAATCGACTTTTTCACTGAGATCACGTTGCC
TGCCCTGCGAAGTGCGCGGGATGGTATCAATTCGAACGTTGTTGTGTGGGGCGTGCACCCTACGCAGAAATTTCGTCTGCTATTTGGCAAAAGTGTTGGA
GCAGGAGGCTTTGCGCCACAACCTGAAATGGAGGTGAACGATGTCGTAGAGCTGTACGGACAATTAGTTGGAATACTCCACGCATTTTTTTCGCAATTGG
ATATGGGATCTCGGCTTCTGCAGCGGCAAGATGCTGAGCCGTGGAGACTGGGTATTAGCAGTTGGATAATTGTGAACAACCAAGCGATTGACTTGTTGAA
GACTCCAACAACTGGAACATCGATTAATTATGGTAGAATGTCATCTTTAGCTGGTCAAGTCGAACCGATGTCGTTTGTTTCGCTGGAAGCTCCATCTTTG
GCTACTGCGTTTCGCATCGTACAAACTGCAAAGACCAATCGTATCGTGCACAAGCAGAACGAAGAAAGTGTTCATTTTTTCGTACGTTTGGCTTTGTTTC
ATGATGGGCAGATCAGTACTGTTCACCTTGTTGATCTCGTCGACCAAAAAGATTTTAAGGACCAAGTGTTGATTCAAGAGAAACTTGAGTTTTACAATAT
CCTACAAGGTCTAAGACAGCGCGCACCATCGCCTAGGCAAAACAGTAGCCGCACTTCGGTTCCTGATCCAATGAGCTCTGGAGGAAAAATGGTGCTATCG
AATTTCATGCTACCGTTGCTAACTGCAAACGCCAAAACATTCCTTTATGCAAATGTGATCGATTCGCGTGCTAGTTTAAGAGAAAGCGTGCAGATGCTTA
ATGCTGTGGCCAACTTACGGGGATTTGCATGTGTTTGTAAACCACTTCGCGACATTTCCTTTGACCAATTGGGTTTTCAAACTACAAACAAGCATGAGCG
ACAAGAGCTCCCTAACCAACTAGCCAAACAGGCCTCGAAACCTGAATATTGCTCGGACTCGGGTATTGTTGAAGCACAACCTACACTGAGTTGTTTGGCA
CCGTCACCACCTCTTGGTTTTCCTCTTCCTGACGCGGCTTCATTAAATTCTCTGCACACGATAGAGAAACAGTTTTCGTTCGAGAAACCAGTGGAAACAT
CCTCTTCAGGTGGAGTCGTCGAGTCCGAAGCTATGAGTTGGCTGAATATGTTTGCACAGCGAAAACGAGATATACTCGGTGGCTCTACCGACACTGTTGC
GGCAATGCAATCAGCACTCAACATATCTGAAAGACCTGCGGTAGTTGCCGCATCGCCCAATCGAGTCGAGAATGGTCAGAGCTACACCCCACCAGAAACA
CAACCGTCTGTTAGCGATCTGTATGAGCAGTTGCGGGAGTCCTTGGAGAATGTCAACGAGATCGAGTTGGGTAGATCAGAGAGCCCACAGGTATCCTTTA
CTTCACCTCACTCACTACCACCGGATCATTCGGGACCCGAGTCTCATGCACCCCATCCGATTGTTGATCAAAATTCAGATGGAGAACGTATTGCACAGGT
CGGGTATTGCAGGAGTACCGTTGGAGGAAGCATTCCACGACATCAACAGCAATCGCAGTACAGTAATGAAGACTTATTTTCTTGGTCTCCATCCACTTCT
GCAGAAGTTAGTCGTCCTATTGAGTGTTTTACATCTCGACATCATAGGGACTCAAA