Description :
From Genome Similarity Track
Location :
Scaffold_170:46724- 48698
Sequence
1974 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCATGACAAAGAGCTACT
TGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGTTACGCACTGCGACACAG
TCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGGCTTAATGTAGTGGCCG
ATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACGACAGTGATGTCGTCAGTGCCTGACTTGATACGCGGAGCGTATGCACAAGACGACAT
GTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGCGTTTAAAGACTCTGACAAGGATTTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCGCTC
GATGGCGGCCTGCTGTACTACAGCACCGACTCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAAGTATCGAATCCTCTATGAGGTTC
ATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGTATAAGTGGGTTGGCACCTA
TGTACGCACGTGTGAGACGTGTCAACGGACGAAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCTCCAAGGGATGTTGGCAGTCCATG
AGTATGGACTTTGTGTTTGGCCTTCCCAAGGACAAGGCAGGAAACACGGGTATTGTGGTCTTTGTAGACCGATTGAGCAAGATGGCTCATCTAGCGGCGG
TGCCGGACACCATAGATGGTGAAGGTACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATTGTCTCGGATCGAGACCC
GCGCTTCACCGCGAAGTTCTAGAGTGCTTGGCACTCGTTTGGACATGTCCACAGCGGACCATCCGCAGACCGATGGTCAAACCGAACGCGTGAATCGCGT
TGTGGAGGATATCCTCCGAAGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCC
TCGACAGGCTACACTCCGTTCTATGTGAACGGCTTGGTTAACCCTCGCGTCCCACTGACGCCGCCACGCAGTGGCTCAGGGCTTGGTGGGGGAGGGATAG
CCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGCTCGCAAGCAAGTCGATGACTTTGTCTCTTTGAGACTGAGCGTAATGCGTCAAGTACGCGACGCTAT
GGCTGAAAGCCAAGACACGCAGAAGGAACATGCAGATGCCAAGGGCAGAAGCAATGTTGAGAGGTTTGAGGTCGGTGACCAAGTTTTATTAAACGCTAAA
AACCTACCTACTCATGCAGTGTCTGCAGTCTTCAAGACGAAGTTAAGACCTCGGTTCATAGGACCGTTCAAGGTCGTGGCCAGGAAGGGCCTAGCGTATA
CGCTCAACCTTCCGAAGAAGATGCGCACGCATCCGGTCTTCTATGTCGGCTTGCTTAAGCCATACCAAGACCCT