Description :
From Genome Similarity Track
Location :
Scaffold_1120:4672- 8391
Transcript NameFunction/comments
g14736.t1RAW24142.1 hypothetical protein PC110_g19429, partial [Phytophthora cactorum
g14737.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
3719 bases(100 bases per row)
CCTTAGTGCAACATGCAATAAGGCACACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTT
CTACCAATGAGAGTCATTCAATAGATAGGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCATTTTTAGGAGGAAACCCCATTTAC
AATCAATACAGTTCTCATTTACCACCAAAGCTTCCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAACT
ACTCCTACGCTTCCTCCTACACGTGCGCTCACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATAACACCTGGTAGCACTTTGTAGTCCGTCCAACG
ACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATG
TTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCG
AACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTTATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACA
CCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGGGAGCCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTACGG
CTCGACGTATCGTCGACCCGTTGCCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGACCC
TACGTGCTTCAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAAAATGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTG
CAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAAAATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCA
CGTTCATGAAGGACCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAACTACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGA
GTTTAGCCTGCGACAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCG
AGTGCGACCGCTGCTAGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCCCGCGAGTGCACAGCAC
CTGTGCACGCAGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATCAAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGA
TGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATTTCACTGCAAGAAGCAAGATGACAAGCCGAACCTT
GTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTTGTGCTCTAGTGGACTGTGGAGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGC
TTGACTTCGAGGAGGTGGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTT
CTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGG
CTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAG
CACATGCACCACGTGGTGCATGCGGCCCTCCACTAGAGACAGCGCGGAACGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGT
TGGGAGAAGATGTGAACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCCAAGCGTCCGGGGCGACGCGGTAGTGTCGACAGGTAATGTC
GACACACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCATCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCA
AACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCTGGGCTGCACGACGAAGCGGTGCGCCATCAAGCCGGGCTTGAACGCGTGCACCCGCGGGT
AAAACCCGCCGGCGAATACAAGGAACAACTGTCCACAGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCGGCACGAGAAGTGAACGGCGCAAG
CGGGAAAAGCTGCGCAAGTCTCGGTCAAGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAATG
TCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGAATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCCCTCCCAGTTACAAGCTG
GAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAAACAG
CTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGG
TCTTGCGTGAGTACAAGGATGTACTCCCGGATGACATTCCTGCGGAGTTACCGCAGGATAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAA
GTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAAGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCG
AAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGG
CGCAGACGCCGATACCTCGCAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTTGATCTGAGAGACGGGTTCTATCAGATCCT
CATGCGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATACCGCAGGGGCTGAAGAACGCCCCAGCG
ACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATCCACAGCCGGGCTGTGAATGGGA
AATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAAGCTGAAGAAGTGTATCTTCGGGGC
GACCGAGATACCCGTACTTGGGTGTCTCGTGGGAAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAAT
GTAAAGGAACTGCGGCAGT