Description :
From Genome Similarity Track
Location :
scaffold_154:4671- 11003
Transcript NameFunction/comments
g3047.t1hypothetical protein
g3048.t1hypothetical protein

Sequence
6332 bases(100 bases per row)
TCCGAGTGCTGTAGGCGACTACAGCGCTCGCCCAAGTTTTACGCCCTTCGGCGGAGGTGGCGGTGGCGGCCTTCGTACGCCGTCACCATTTCCGGAATGT
CCTCCATCAGGACATTCCGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATACGAAAATGAACCGGACCTCGGGTCTGGTTCCGATG
ACCAACAATTCGCTGGACGATCCAGCGAGTTGCCCCGCGTGCGTCTCGCAACGGGGGTGGGGGGGGGCGGGAAGACGCCCCGGGTTTGGTCAACCAAACC
TTGAGTCTCGCTTGGAGGCTGTTGAGCGTCTCCAAGCGTCGCAGTTCGCTGCTCTGCGTCAGGAGCTGAGCTTGTTAAAGGCTCAGCTCGCGGAGGTTGC
GCAGACGACCTCGAACGTAAAGGTCGAGGTCGGGACGAGACTCTCTGGCGTCTCGAAGCGCGTCGCCGCGCTCGAGAGCGCTTTGGCGAGTCACCAGACG
TAGGTGACTCGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATG
CTTCGCCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGAGTAGCTAACAGA
ACTAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGATGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAA
ACCGAATTACGGCTTGTCGACGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGC
GTGATGTTCGTTGTCGTTTAAAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGAT
ACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGC
GTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCA
TTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATG
GACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTC
TAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGAC
CACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGC
GGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGGTGACTCCAATAGAAGTCAC
GCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCATACGTGATCTTGAGCTTCAGCTCATGATCATCCGG
CACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGC
TTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAATTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACTTCGTCCAGCAAGGACG
ACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAA
CCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATCGCCGTACGC
AACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCAT
GTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGAT
CGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCGAAG
GCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACA
AGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCC
GTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGC
AACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGC
GCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGG
AGTGCTTACCGCTGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATC
GAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTG
GTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGAC
TTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCA
GGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCT
TCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTG
CTCGATGCGTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATTCAGCCTC
ATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACATTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTA
GCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCC
GGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCAGCCCG
GCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGTCTTCTTTACCTC
TACGCCTAACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTACCTGTCGACACTACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCGGA
TTGAACCAGGCCCTGCTGATTCGGTTCACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCATTCCGCGCT
GTCTCTGATGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCG
TGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTC
GACGAACTCCTTCTCTTGGTAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGA
GGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTC
TCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTG
TCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCAC
GACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTG
CTGGGAACCAGCAGCTGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATTAGCCGTGGGGCGTTCACATGC
AGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCC
CATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGC
ATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAAC
TCTTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCG
ACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTG
GAGTTTTAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCG
TGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACA
GGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTA
TTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGC
ACGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCAAACGAAAGCTTTGG
TGGTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATC
TATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATG
CCTTAGTGCATGTTGCACTAAGGTAGGAGGTG