Description :
From Genome Similarity Track
Location :
scaffold_10:4670- 7463
Transcript NameFunction/comments
Pl_112535conserved hypothetical protein
Pl_112536cytosol aminopeptidase, putative

Sequence
2793 bases(100 bases per row)
GTCGCTTCTGGAAGAAAAGTGGTGGAGGAAGTTCTCGCGGAAACAGCAGATTATCCTTGATAGCAGCGACTCGATCTACTCGAGGAGGCTCACGATTCTG
TCGTTGAGTAATGTGTCGTGGACTATTAGGAGTACGCTGTCGCGATGTGCTCTTGTAATACATCACGTGTCCATCAACAACAGAATTCTGAGTCATCATC
GTCTTCGATACTCCTTTGCCAATATCACTAGTGCTAGAATTTCGCCGAGGCAACGACTCAAGCGACTCGGCTGCATCTTCAAAAAGCGAGTCCTCGTCGC
ATTGAACACCAGAGTCCATCTTTTCCACTCCACTTATCTCTTCCTTTGTGTTCGAAGCTAGTTTCTTCTCATCACCCTCTTCCACATCTGCATCTGCTGG
AGTTGGCGGTCGTTCGGCCAGCTCCTTCATCTCCTCCGCTTCCACGTGTGGACTTGGTGGCTGCGACTTGTTTACCTGCACGCCTAGTGCCTGTTTTAAA
TGTGGGGCGAGTGCCTTGCCTAGACACGACAATGTGATAACTCCCGTGACGCTGCCCACGACTGTATTATGGTGATCTCGGAGCTCCCACGAGCCACTTT
GACTCGCCCACTCGCAAATACGAAGCAGTCTGCTGCAACTCAATACGTCGTCCAAGAGTCCCACATGGAGAGACAGCGACACGACAGCAAAAGCTCGTAA
TCTGGCTCTGCCGTGTTCTATGGCGAGCAACAGCAGCGTCAGAGGCGCCTCAACTTCCTGTTGCAGCTCGTGCAGTAGCTCTTGTGGGTCCGTTTCAAAG
AGACAAGACTTGCCATGACGTAGCTTTGTCACTGCGTCTTCAGCGGAAGCTGTAGAAGTCTCGGCACAGGCCAAGGCATCGTCAAACATGACGATCTCGT
ACTGCAGCAGTTGAAAAGCGAGAAGCAGCGAGCTAGAGGACGTCGGTACAGGATTTAACACCACCCGATCGACGTAGAATTGAAGCGAGAAGAGCAGAGA
AGAAGAGAGATGCGTGGGGGACGCGCTGTCAGAGTCGCAGGACGCCACCGAGAACGCGTCCATTCGAGCAGCTCAACTTTGTGACCATCACTCTGTCGCT
AAACATTTCTATAGATGTATACCCATTTCTATAGGTCGACACATACATTTCTATAGATCTAAAGTCATTTTTCGTTTTGGGTTTTAGATATTTTAATGGG
CTTTAGAGAAATCGACCGAAAACCTGACGAATCGGCCAATGAAAAACGCTGCACAGCTTAAAACAGGGTTGTATTTCCAAGGAGTGCAACGTTTTTCATT
GGCCGATTTGGTTAGCGCGACTGACAGAATAGAAGACCGCGCTTTATTCGGCATTATATATAGTAACCTCACATTTTTCCGTTTACCGTATCCGATGCTG
CGTCGCTTCTTGAGCGCTTCTCCGGCGTCGGCCGCGCACCGCATGGTGCAGCAACAGGTGCAAGGTCAGTTGTCGCTGCTGCCCAGGACGTCGTTGACGC
CCTCGACGCGCGTGGTGTTCGTGTCTCGCTCGGATGCCGCCGACCTGCAGAGTTCCCTGTCGTTTCCTGTGTCTGCCGACGCGCTGAGTGACTTCAAGGC
CAAACCGCAGGAGAAAATGTATCTGTATCCGAGCGTGGACGATGCTGCGTTCAAGGGCCAGCGAGTGCTGCTTGTAGGGCTCGGAGACATCGACAAGGTG
ACCCCCAACGTGCTGCGTGACGCCACGCACGGCGCGTTGAGCACGCTCAAGGCCAAACGAGCCAAGGAAGTTGTGGTGCAGATGCCCAACCTCAAGGGCT
GCAAACTGGACGCCAGTCGCGTGGTGGAGCTGCTGTCTCAGGCGTCGATACTGTCCAACTACCAGTTCGACCAGTATCTGACGGACTCCAAGGACGCTTT
TGGAGACAGCAAACTGCGTCTACCTCTCGAGCAGATTTATCTGGACGCGTCGACCGAGTTCCAGAAGGTGCGAGATAACGGTTTGATATGAAGTAGAGAA
AACTAATGGCTGGTTTCGTGCTGTAGAATGTAGCGGAGCAGGTCGCGGTGGCTGAAGAGACGATCTTCGCGCGCAATCTTGGTGGGTAGATAGCGTCGTG
GCGTGGTAAGATTACTAGAGCTGATTGGAGCTTTTGTTGTTACCCAGGAAATGGCCGCTCGCACATTGTGAACCCGGCTTTTATGGAGGAGGTGGCTCGC
GCATCGGGTGATCTTCCCAATATGTCGGTCCACGTGCTGCAGCAGAAGGACCTTGAGAAAGAAGGTATGAACATGTTTCTGAGTGTGGGACAAGCTGGCG
TTTGCCCTCCTCGTCTCGTCATCCTTGAGTATAATGGCAACCCTGATTCGGACGAGAAGGTTGCGCTGGTCGGCAAGGGTATCACGTTTGACACGGGTGG
CTTGAACCTCAAGCCGACAGGTGCCATCGAAGACATGCACACCGACATGTGTGGTTCCGCCGCTGTGCTCGGGGCTGTCCGAGCCGCTTCGCAGCAAGGT
CTAAAGGTGAACATTGTCTGTGCCCTTGCTCTGGCTGAGAACGCGATCGGATCCAAGGCCGTGAAGCCGCTGACGATCGTTAAGTCGCACAAGGGTATCA
CCGTGGAGAACAACAACACCGACGCTGAGGGCCGTCTTGTTCTTGCTGATACGATGTCTTACATCCAGAAGGAGTACAAGCCCAAGAAGGTTATCGACGT
AGCTACTCTGACTGGTGCATGCATGGTCGCTCTTGGTGAACACTGCGCCGGCTTGTTCTCCAACTCCGATGACCTAGCCAAGAAGCTGCAGGA