Description :
From Genome Similarity Track
Location :
Scaffold_3260:467- 2033
Transcript NameFunction/comments
Phyta_totarag15179acetolactate synthase small subunit, putative

Sequence
1566 bases(100 bases per row)
TAGCAATTTGCCTTGATTATGAGTAGTTAACTAGGTAGACTTCTCTTCAGATAAGGCTACAAAGCACGCTAGTCGAATCGACACGATCACTCCAGTGCGC
GCATGGGAACGCACCACctaccaagaagaaaaaggcaACTCCAAGACTGTAGACGCTACTACCGATATATCCATGACCGTTTATCCAGGAGGGAGGCGGG
AGGtgtcgatctcttcgtcgtcagccTCGTCCAGGAGCGTGCGCGTGGCGCCCTCGAATGTCGAAAGGTCGCCCAGGTTGTCAgtcacgctggtgctgcg
agCCATGGCGATGACACCGCTGCGGTGGATCTCTGTGATGCCCAGCGGCTTCAGCAGGTCCAAGAAGGCTTCAATACGGCCAGGAGTACCAGCCAGCTGC
ACCATGACTTGGTGCGGTCGTACGTCGATGACCTTGGCATCGAACAGgttggccagctccacgacctcaGCACGAGATCCAGCCTCTGCACGTAGcaaca
caccagcagcaagtgtcAGTGTAAGGTCCACCTACAAGAGATTTTGGTTGTAGCAGTGCCAATAATAGCATCTTGAAGCTTGGACGTACCGGCCGTGGAC
ACCTTGGCCAGCATCAGGTCGCGCTCGACGTAGTTCTTCGCGGCGTTTTTGCCGCTGCTGAGGATGTTGACCACCGCCACGTACACGACGTCCTCtagct
gcttcttcatctgcaaaaaaaaagaagacaTCAACAATTGTCAATCATCATTCTATCTCTCTTCCAATTCTACGTCTATTGTCCGTACGTTGACAACACT
CTGAGCAGTGCCATTGACGACAACCGTCATGCGAGAGAGCTCCTCGACCTCCGTGCGGCCCACCACCAGACTGTCAATGTTGTACCCTGCAGCACACACA
CaatcacacacacacacaaaataCATCAGAACCTCCATTTTAGCAGCTATATCCTCGAAAGCCTCGCTATATCTACCTCGAGCGGCGAAGAGATTGGCGA
TCTCGGCCAGACAGCCGGGCTGGTTGACCACCAGCGCGGCGATCACGTGGCGCTGGCTCTGCTCCGCCACACTGAAGGCGCGCGAAAAGTACTTGGGGTC
GACGCAGGACGGTGCGATGGCGGCCGTTGACCGTGGAAAAGCGCAACGCACCAACGGCAGCACGGACCtccgcagcatcttgacgAATGTCGAATGTGGC
GTCTGAAGCTCGTGGTCCCAGGTTCTACATCGGGTATTGGAATGTGGTGTGTCTGCGCAAACACAACCAAATCCGATAAAGTACGAAAGAGCCAAGTGAC
AGGCGCCAGAAAATGAACGTGGATCTGGCGCTGGTGTGCGCGTGGACGCTGCTCTGCTGGGCGTGCAGTGACGTGTCCAGACCCCCCCtagctgttgcag
cagctccggctCCCCACGAACTCGTCTACGACCCCGACACTGCCATTTTCACCGCTCTTCGGGGCTTCGTAGACCCCTCAGACGCTTTAAATGACGTCGA
TATCGACGCTCTGCTCGCCAACATGACGATCCACCAGAAGGCGGCGCAAATGACGCAGATGGACAT