Description :
From Genome Similarity Track
Location :
Scaffold_550:467- 10586
Transcript NameFunction/comments
Phypl_g9329hypothetical protein
Phypl_g9330hypothetical protein PHYSODRAFT_342126
Phypl_g9331mitochondrial-processing peptidase subunit alpha, putative
Phypl_g9332conserved hypothetical protein

Sequence
10119 bases(100 bases per row)
CTTCGTCGACGGTACACTGTTCGACCGTGGCGACGTCTGAAACAGTGGGTGGCGGAAACACAGCCTCAGGTTCGGCTATGGCAAACTTTTTGGAAAATGT
CGTGTTTGGTTTTAGAAACGAATTTTTCTATACGTGAATGTATCGAAATCTAGTTTCTATCAGTAGAAATCGCCGATTTCGCGTCCGTCCATGTAATAAT
GCAAGTGCACAGTGATGGGACCCACAATCGTCGGCACAGCCGGTGATGCAGTGACGGTCGCACTTCCCGGGCGACGTGTCGATCGGCGAGGCGGGATCGT
CCTCGCCGGAGAGGGCCCGTCGAATGGTGGGGGTGGTCCTTGATANGTGGTCCTTGATACTCGTTCAGACGGCCGAGACGCTTGAGGTAGTCGTAGCGGT
TACGATAAACCTTCTTTTGCTTTGCtagctgcttgcgctgcttggcatATTGAGCACCGCACGCGAACACCTTCTTTAGGTGGCGCTTCATGTTTCCATG
TGTCGAaaagcgcttcctgcacttCGAGCAGGTCTTGGAGCGGCGAGCCATTTTCCCAAATGAAGAGATTCAGCAAAGATTAGTTTTGAAAAAACGNGGC
GAGCCATTTTCCCAAATGAAGAGATTCAGCAAAGATTAGTTTTGAAAAATCCATATCAATTTATACAGCATTCGTCTGTCAAAAAGTTGTTCCTATAGTT
GGCCTGTTCCGCGGTTGATCCAAAAAAAAATTCCGCCGGGGCTGGCGTTAGATAACAGAACCCCGGTCGAATATAACCGCACGTAGAGGCAGCAAAAAGC
CCACAGAGAAAGATAACACAAGGATAGCAAAGCAAACCAATATACTAACAAATACACTGGTGCTCTCTTGCGTCTAACCTGCCCAGTTTGCGAGTGAGCT
GAGCTATGTTTCGGCAGCTCCGCATGAACTCACGACGAGCAGATTCTGAAGATACGATGGGTATCGACACTCCACTTTCACGTCAACAGCATTTGAATGA
ATTGACGGAACTCGCACTCTAGCAACTAATGACTCTGAAAACTAATTCATTCTCGGAACCAGGCCTGCCTAACAGAACACGACGAGTCCTACTCCGGCCG
TATCCCTCGCCACGAGGAGAGCTCAAATCGGGTCTCAGATGAGACATACGAACTCTTGATGCGACAGAAAAGGCTACAGTTTCCGGGACGCCGATTTTGT
CGGATCTCGAAAGTTGACGGAGCGATACGAAAGGATATATGGTGGTGATAatggcggtggtggtgagaATGGACTGTCTCGCGGCAGAACGGGCCTCCTC
TCGGTAACCCCACTTTGACCCGACGCAGTgcgagaacgagaagatGCAGCGCTATCATAGCGCCTGGCGGGTTGATGGTGATATTATTAGACTGAATGAA
AGCTTATTTGGTCTCAAGTGCCTTTATTTCTCTTTATAACCCCCTACCTATTGCTATCTAACAGACGTGCTCAGACGGAAGCAAAAGGAGGAATGAGGAG
CTCGTCCTCAACTTCCTACCTCTTTGCTTCCCTTCCTCATCGCACCAATAGTTGCCTCGGTCAGAGAGGCGGCAGGAGCCAATAGAGATTGGCTCCTCTA
CCAACCATGTGGTCGTAGTACCGTAGACTACATAGACGCTTCAAATGGCATAATGTAATCCATACAACATTATTATTCTGTCTCACACAATACTGGTCCA
GCCCATCCTTGGATCGTCTGTCGGTCTCTACCGAACAGACGCATCCCTTGGTACTGTAACAGATCTCAAATGTGCCTCAAACCAGCATTTACTTGTATGA
TTTTGTGTACGCCACACAATATAAAACCAGCATTTACTTGCATGCTTTTGTGTACGTCACACAATCTGAAATAGAGTCGCCACCACCAGTCCGCATCAAA
ATGCTGTCGCGTCTCACCAAGCTCGGGACGCTGAGCGCGCGCGCCTGCCTCGCGccggccgtcgtcgctccaGTGCTCTCagccgccttctcctctcCGG
CCGCCAaccggcgcgcgcggcgtctGCGCAGATCGAAAGCTGGCGCCGAGACGGTCGCCCCGGACCCACGCACTCCGTCCCTGCTCGCGGACATCGATCA
GCTCTCCCGCAACgggctggcgcagcgcgtggagatgccgagggagctgctggagcgactcACGTCCGTCGTGCGCAGCCGCACGCACTCccagctcgcg
gcgctgcgccagaagCACGTGGGCGACCGCCGGAATACCCgtcagctgccgctggacaTGAGCAAGACGCCGCTGGGCTGGACTATGGACCGTAGCCAGC
AGATCCCGCCCTATGCCTACGGACCGGCTGAGACGCTGGCCTTCCTAGCCTTCGAGATGGAGGCCACTTACGCCTGCACGCACACCGTAttcacggagct
gcagaagcggcTGCCAGACTTCAAGCCCAAGTCCGTGCTGGACTTCGGTGCCGGCCCTGGCACAGCCTCATGGGTGGCCAAGGACTTCTACGACCAGTCG
CTGGACAAATACCGCGTGGTGGAGCCCAGCCAGTCCATGGTGGACgcggccgaggtgctgctcgaggacttCCCGGGGCTCAGTGTGCGTCGCAACATCG
CCGACATGTCGAGGGACATTGACGCGGGAAACAAGTACGACCTCATTGTGGTGAGCTACGTGTTCTCGGACATCACCAACGacttcgagcgcgtggtgaC
CACCTCAGCGCTTtgggagctgctgaacgagaacgGATGTCTTGTGGTTGTGGATCGTGGAAGTCCGTGGGGATCGCACCACGTTCGATCGGCGCGTCAG
TTCGTGCTGGACTCGGTTgcggaagatgaaggaggaaAGCAAGGTGTCCGCATTGTGGCGCCCTGCCCGCATCACTTTGAGGTATGTTGTCGAAGCAGTT
TGATTTGTGTTGCTAGGCTCCACTAACTGATGTTTTCCGCGACCTCAATAGTGTCCAGCCGCAGGTAGCACGTGGTGCCATTTTGTGCAGCGTTCACCTG
TGGTGAATCACCCTCGCGAGGCCACCACCAAGCGCTGGCACGGTCAGAAGGGATCCAAGTTCTCGTATATGATTATGCAGAAGACTCGCGAGGgaagcga
cgaagacgcggctgccaagaagaagaagccgattGCTCGCATGCTCAGAGCTCCTCTGCTGGCTACCCGCCACGTGCATCTTGATCTGTGCACTCCAGAG
GTAACCTTAATCGCTCCTCTTCGCTCTGAATTTCCAACTGACACTTATGTTTCGCAAATGTGCAGGGAAAGCTGGAACGCCGCAGTGTTACCAGAGGTAA
GGCGGTTCGCGAGGTGTATCGTGCATCGCGTAAGGCACACTGGGGAGCGTTATGGCCAGCTGACGCGTCCAGTTACCTGAAGGACAAGTAGAATGATACT
TGCCATTTCCACTAGAGGCTAATAGACGCAGATGACCATGATACAGTTTTGCTACCAGTGTCTTCAGCCGAAGGCTAGTTTTGATGTTGTTCACTGCTGC
AGGTGTTAATAGGCTTTTCTCGGGATCTTATGCACCTCCACGGACGCATCGTCAAGCTGGATCGTGATTCTGTTGTCCAGCCCGCCACTGTCTGGAAGTT
TCCCAACGAAGGCATGCCGCGTCGAAGCCAGCCTGGGGAGTTTGGATACTTGTtcgtccacttcaacgtcgtctATCCAACCGAGCTAGACGCTGCCGCC
AAAACCTGGTACTGTAGCACACAATTAGTTCTACAACTACGACGTTCAACCCAAGCTCACCTcgttgtgctgcagccgtGTGCCAGCTCCTGAGCGACTG
AATCGAATCACCAGAATCGCGAGACAGAACAGCGGCTTTCGTTTGCCGAGCATTGTCGTTAAAAAGTTGGTTCTTTTTTCTTGCATTTAGTGCGCTCTTC
GCACGCCGCGTCACCTGGGCGCTAGGATAGCTGCGTGTGTGTCTGCGCAGTCCTCTCTCCacctcgctggcgctgtgctTACCCCTTCCTTACCCGAGGG
TTCTACCGCGTCATGGCGCTACATCCACACTCGACGCTTTCCTGTCCGCACTCAATTCCAAGGTCACTTCGACATGCCTCACCAAAAGCTCGGGTTGCTA
AACTGATGTATGTACCTCACTCTTGATCGATCGTCTTGGTGGTTTACTGCAGCTTGCTAGCAACGGCATCCACGTGGGGCACGGTCGACAGCTTGCCGAT
GGCAGCCACCGAAGGGGTAGCCTTCACTGCCTTCTGAGCCAGTTCCTGCAGCTTAGCGGCGGTCACGCCCTCAACGAGCTCCGACGGCGACTTGGACACG
AAGTCCGTAGTGGCGATGAGGCCCACGCGGCTCAGAGTACCCGCCTGAGTGCTGTAGTGCTCGAAAGCCTCGAGCGCAGCCGTGGTCTTGGCGGCAGCCA
GCTCCTCTTTGGTAGCGGGGGCCGAGgcggccttcttcagctcagcagcaaacgaGTCCACGAGAGCGCCAGCCTCCGAGGGAACAGCATAGCCCGACAG
ACCGAAGAGGGCGGCGTCGCTGTAGCTCGACAGGAAGGCCGAGGccttcttgttgttgagCCGCAGGCTCAGCAGagcgcgcagcacctgcgaAGCGCCA
AAGTCGGCGGAGTCGCGGCCAACGGTGGGCAGAGCCAAAGCGACGTGCGTGAACTTGcccgccttcttgacgcggGACTCGCCGcccacgtacttggccg
agacgctggcggccttggcgcccTTGGCGAATGAGCCGAAGTACTCGTTGGCCAGGTCGGTCAGCGTGCTGTGGgccacgccagcgccgacaaggGCGGC
GTTGGACGTGTTGACGTACTTGTCGTAGTAGGCCCAAATCGCCTCGGGGCTGAGCGCGTTGAGGTTATCCgcggcagcgagcgagcggcccagcgtcacg
tcgtcgtagaaggcggcggcgtgcacGCCCTCGAACAGCGATGCCGAGGCGTCCtcggcgatcttctcgaactcggcctGCACAACCTTCTTCtggtcgt
ccacgtcgtAGAGCGCGAACTTGGGAGCCAACGTGGTCTCGGCCAGGATCTCGgcggccgcctccagctggtCGGGCAGCACGCTGACGCTGTAGCGCAC
AAAGTCGCGTCCGGCCTGGGCGCTCGCCACGCCGCCGATGGCCTCGATGTCGCGGTACAGACGCAGGTCCGAGCGGCTCTGCGTGGCGCGGAAGGCCATC
TTGGCGAACAGCTGCGAGATGCCCGCGgtctcctcgctctcgtcaCGCACGCCCGTGTTGAGCTGCACGCTGATGGTGgccacggaggcggcgcggTCGT
CCGAGCCCAGCTGGAGGCccgacgaggccgtggacgtggtcagcttggctgcggcggcggcctgcggCTGAGTCTTGGGCACGGACGGGAACTCCTCGCT
CAGGGCCACGCTGGGCATGGTGCTGGCCTTGGTGaacagcgagcgcgacgcgCGGGCCGCGAGCttggaggacgacgacgcgagCATCTCGGCGACGGGG
GTCTGGGCGGCAATGAGGAGGGGTGCTGCTCCAACGCGTTTCTGTCGGCGAGCGGCGCTGAGAGCCGCACACGCGCCGCTCACCACCAAAACCCGCCTTT
TCACCTCGTTTTTGAGGTTTTATGCTGCTTTTGCACTTGCGCTCAGTATGCCCGAAAGATCCTTACAAAGCCAAGTCAATAAGCGAGAGCGGATCGCACC
TTATCGAGTACATGCACCACACCAGTCGCAGAAAAACGTCGCTACAAGGTGGACACTAAGTGTCCACTTCACAAGTCTTGCGCGAGCGGCTTAGAGCTGG
AAGTTCTCAACGCCGTCCACAGCACAAGTAAGATGATAGAAGTTCTAGAACTGCCAGGACGGCCGTTACGCCGTGCGCAGCAAGCACTAGCGGCCATCTC
CGGTTGGAATACGTTCAACGCGAGCGTGAACGACCAGCCGACTCGACGTCTCTCCCTCTCTTCGCTTCCGGAAAATCCCTAGTGGCAGCATACAGTGTAC
TCTCTGGCCTGTGAATCGCAATTCGCAGCAGCTTTTGAGACAAAACAAATCTAtgagttgaagttgccccAGGAGTGAATGTCGTCGCACTTAGGTGGAC
CAACACGGTAGGTATATCACGCCCTCTGCCGCTTCATCACTACAAGCGAATAAGGGCGGCAAGCGAAGCCTCAAGATCGCGCATACGAGAGAATCCAGCG
GCTGCAAGGCACAAGACAAGCCGCAGACCAAGAGAAACAAGAAAAGCCAAGAAGCCAAGCGTCAGCGCTGCCCGCCCGACCATGGAGAcgaagcgcgtgg
tggcgcGCTTCATGGTGCACAAGGTGGGCAGCTTCGTGGtcaaggagcgcgtgctgtgcttCGGAGAGTACTCGTTCTCGACGCTGGACCGCGAGAACCA
GCAGGTGACCAACACGTGGCCCTACGAGGATgtggacagcgccagcgtgctcGAGGGCGAGACGGACTTGGTCATCCACACGCCGCGCCACCGCATCAAG
AAGACGGTCTACCGCTGCCACTTCCGCATGGAGGTGCTCGTCTGCCTTATGCGCCTACGTAGCCAGCACTACGCCAAGATGCCCAACGCCCCGCAGCCCC
GGCCCgctgagctgcagacgcacgCATTCCAGAGCCTCAAGTGCCACAAGAGCGGCGTACAGTCCACGTGCGTCGTGGAGATCCGCCCCGACGGCATCTA
CCAGAGAGACTCGGAGGGAGACCTCATGAGCCACATCCCGTATACGAGTCTGGTCTCCATCGACCTCATCTGCGACGACCACGAAGCGATTGCGTTGAAT
CACTCGGACAACTCGAGTATCTTCATCGTGCCGAGACGCACAGAGCTGGCACAAGCTATTAACAGAGTCATGAAGGCCTACGGCATGCAGATTAACGAGT
ACCGCAAGAAAACCATGGAAGCGGCGTTGAAGGATGACGGCAAGGCGTCCTTGGGCACTAGTGTGTCGTTCGAGTACCAGGTGCTCAAGGTCTCGCAGTC
CAACGAGTCCAGTGCAGTTCCACGGACATTGTCCGTTTCGGAAAAGTACATCACGGAGTATGCAGACGCCAAGACGGTGATTTCCAGTCGACCCTTGTCA
AGAATTTACACTTTGATCATGTATCAAGACACGCTACAGGCGTTTGAAGTCGTGTATGTTGACGGCGTCAAGCGCAAGTACTATTCGGCGCAACGTGAGA
AGATCGTGTGTGAATTGTTGGCATCTTGTCACTCGATGGGGAACTTTCAGGTGGGTGTGGAGATGACCGAAGTTGCAGACTCGGTGCGCATGATACCACG
CAAGATCATCTTACTAGAAGGCAACAAGATCGCGAATACGGTGCCGAGCGTGAACGTGATGGACCGTGAGCTACGTGCCGCACAAGCTAATATCTTGCAG
TTACTTGCGGTGCATGGATATCGTAAGACAGCACGCACTCAACGGCAGCTTCCTCGCGGCCTTGACGAGGAGATGCACTCGTTGGCTCTGGAGCTTAATG
CAAATACGCCAACTTCCGGTGTGATTGCACAGCCCAACAAGCCTTTCGATAAGGTGATTTATGTGATTGCACGTGAGCTGCATGATATCGTAGGCCGCCA
CGGTGCTACGCATGATTTCGTGAGCACATATCTTCAGTCACTCTATCGCTTGACGCTTGCGCCACCTGCCATCAATGAGTTCATGAAAATTTTGACAGAG
GTACATTGCTAGCTTCCTCATTATGTGCTTCTGGAGTGCAAGGCTTAACCTTTTTGTATGTGTTTGCCTTATTTTTTAGCGTGGAGAAGAATACATTGGC
ACAATATCGAAGATTTTGGGGAGCAAGGACTCCGTTGCTATTTACTGGATGTTCATGGTGCTGAGCCGACTGATGGAGGCAAAAGCGCACAAGCTTCAGA
GTCGGCAACTTTTGCTTTCCAACGGTCTCTTCATGATGACGCTTCTGTCATTACTAGACGAAGATATACATGTAAGTATATCCGCAAGTAGACCTTGACA
GCATTTCTGTATCTAACATTCGCGTTTGTGTCATGTAGACGGGTGCATTTTTGTCTGATCtgccgacgatgaagttGTGCCAGTTTATTCTGTTACTGGT
GAAGGCAAACGTCGAGAAACAGCGGAAACTCTCAGAAACACTATATCAGCACTTGGCTACTAAATACCGCATGATGCTGCGAATTCTCTTCAGCTTTCCT
GGCTTAGCTACTGTGGAGGCCTGTGTGGGTATTCTGAGCAGAATGACGAAAAACCCAGCATTTCTGCACTTTGGCAACATGGGCTCTCCGTTACGGTCCA
ACGATGGAAAGATTCCTCGACAATCACTCAGCTTTGGTGAAACATTGAACTTTGGTCCAGGGAGCCAGCGTGGGGCACCAGTTGCTCCAATGTCTCGGCC
CCCATTGTATTCTTCCAGGAGAAACAACTACGCGTCAAGCCGGAACAACACATTCTCGTCATCTGGATCATCTTCTAGTGGTGGATCTAGTCTTCCGGCT
AATGTGGTGGTCGTTCAGAACCCGGAAGTGCTCCTGCGGCAATATCGGCAATTTCTCGAAGCGGCATGTGGCTCATTAAAGATGGGGATCGACCAGTACG
ACGACCCGGTCTTCTTGCGCCTTCGTTACAGATGCCGCAATATTTTCTTGCAGGAGCTGATGAGTCATTTGGTGGGTAATTTTGAGGAATTCAAGCGCGT
GTACAGCGTTGACTGCTGTCAGTTCAGTGGTTTCATTGGCACAGCAGATGGGCAGCGAGAAAAGACCAAGTTTTACCTGACCCCGCGAGCGCTGATTGCT
GTACGAGTTGTAACGAAGCATACTCATGAGTTTGAGTTCCGTACAATTGAAGAGATTGCTCAAGCGACAGCAATTCCTGACGCGTTTATTATCACGGTGA
agaacaagttgaagttcaTTTATTCCGACCAAAGTTGCGACATCGTAGAAAAAATGAAGGCTTTAGCTGGTATTATTGGAATCCATCTTCGGTTCAAAAT
TCGCGACAAGCTTCCAAAGCAGCAAGTGGAAAAGCCACTCGACCAATCCGCTTTTCAGTCAAATGATTTATTTGATGTCCAGCGACGAACTGGTCGGCAT
GGATCCACGCACTTGCGAAAGAAAAAGCTTTGTTTCGTCGACGGAACTATCGAAGAGTTCACCAACAGTTCAAAGAAGATATACGATCTGAAGAATTTGA
GGTGTGTAGTGGTTCCTGGATTGGGGAGTGATGAGACGCAGGCTGTTGTGGCGTTGGAATTTTCGGATAGCACTCGTGTAGTTTACGCGCCATACGACAT
CGAAAAgttcttggcggcgctgtaTGATGGATACCGCTACGTCGAAAATTATGATGTATCGCTAAGCCGCGAGTTCTCAAACTTGAACCCGAGAATGTCT
CCTAGGGCACTGTTGaaggacgagcacgaacGGTTTCTCTATCTAAACCAAGATGGTCTCTATATTCCAGCACATTCAGTTCTGGAGAAAGAGATTGAGG
TGATGAGTGCTGAGGGCGTGAGTATCACATCCGCGACAAACAGGGTCACATTTGCACTTGAGAGCTTGAACATGAATGTTGAGATGGATGATTTTGCGGG
GAAATCCATGCGTGGGCGCCTGGAGAAGCTATCATTCAGTTCCTTGCTTCGGGGGATAAATAATTTGGTGAGCGAAGCTTGGAAAGGTTTTAACATTTTA
ATGTGGTAACTAACACCTTGTTTCTTATATTTCCCCTTGTACTTGTTATGGGTCAGCTCGAGCACTCCTGCAAGCCACCAATTCGCGCGAACGAAATTTG
CGTTGTTCTCGAGACGTTTTGTCGAATCAACGACGGTTGCTATCGGATTGCGATGGAACAGTCAAACGGCGGTGCAATGGTTGTGGTTCCAACTCTGGCT
CAAATCCTGGTATCTGGTGATCCGATTGCAACTGTGTGGGCAGTAAACGCACTTCACTCACTGGTCGCTGACAAATCGCGGTCCAATGGACATCGAGTAG
CTGAAAAGGCCATTCGCTTTCAAGTATTCGAGCATAAAAAACTTATTTCTCTATTGACTGGCCTACTGGAACAGAGAAATCCAAGCTCCACACTCGTCAT
GCTGCAACTGGTCCTGGAC