Description :
From Genome Similarity Track
Location :
Scaffold_248:46696- 55609
Sequence
8913 bases(100 bases per row)
CACTGCCTCCCGTGCGATCTTCGTGGGCTCAGTCGATACCCTGATATCTCGCTCGCGTGTCTAATTTCACTGCCCAACTTGCATTGCGGTCGACTTGCGG
TATGAGTTTGATCACGGTGGGCGAACTGGACGTGGACTATTTGTTCCGCCACTTCTCTCGACCCAAGCATTACTTGTTTCCAGCATCTGAACCTCGTGCT
CGCCCACCTGCCGAGTCACAATGGTCTCCGCGACTTATGACCTTGGCGCAGATCTATAACTTATATAATCAGAGTCCATGGGATGTCCTGGATCGACCGC
TTGCGCCCGTATCCTTCCGTCCAACTGGCTGGTTTCAAGCGTTGGTGAACGCCTACCGCAACTTCGAGGATCATCACGGCCAGTCGCTATGGGAGTTGAA
TAATGTGTTACCGATCATCGTCGGTCCTAGCTGCTCGAAGGATTCTGGGTTGAGTGTCTACCATGAGGAAAGACGACGTAGACGTTCAAGATCAGGCCCC
CGTTGAAAATAAGTACTCCGGATCGTGTTGCAGAGGTTGATCGAGGGTCGATGTGACCTCGACATCCTGCTGGATCCCTTTTTTTGCAATTCCCCGGAAG
ACTGGAGAAGTGCATGTGGTATCCGGGTTTTGGCTGCCGACAGACCAAATATTCCCAATTTGTCTTCCGCCCTGCACTTGACAGACTCTGCTGATCGCTG
GCGAAATCAATATCGTACGGCGACCACCGATCACCCTGGGTCATCCATTTGCCGCCTCAAGGAGGAGTTCGTGGAGAATTACTTTGTTGGCTCTTTCAGA
AGGACAATAATGTTCATGATATCAGTTGTGATACCCGGTCATATCTACTTAGCCTGCCTTCATTGTACTTCAATCGTTTTCACATTCCATAATCGCTCCG
TTCATCGACCGTGTTACCTCTCCTCATTGCCAACTCACATGGTCCAAGCCTTTTTTGCGCACGAACCAGATGATCACCACAATTCGCTGTCGAGATAAGC
ACCTCTGGTTACCCTAACATCTGACCTCGTCTTCTTGTACCTGCATCACTTCAAGCCGATTCCTATAAGCACGATCGCGTCCAAACTAACTGTAACAATG
CGCCACAATTTAGGGTTCGCTTCATCCACCCATTTTCGTCTTGATGACCTTTCCACCGGACTAGAAACTGTCGGTGGGTTCTTCCATACCGCGTTTTCCG
CCCGGATCGCACATCTCTGATACTGTCCACCTCTCATTCCCCTTACGCCAAATTACCTTCCCAGATGGCTCTCGGAAGTAGGGCTTCATCGAAATCCACT
CGTCCGATCTCTTTCACATGTAGCCGTGCAATAGGTAGGTCAGGAATACTTCGGACCAGCTTCAGCTTTGATATATACACGAGCGGGAACAGTCGGTATG
GGGTTCCTTGCACTTCGAGTCGTACTGAATGTTCCCCGCACTTCTCGATCACTCGAAATGGACCATGCCACATGTGGGCCACTCTTCTAGAATATCCCTT
TTTCACTAGGTTCAAATACATTCACACTTGGCTACCACAGCTTATTCCATGTGGTTCTTGATCATTTTTGTGTTGATCGGCCCGGTACTAGATGGATTAT
TTCAGTTGATAATTCAAGGTGGCCCGCACACACTGGTACTGCTGCTGTATATGATAACACCATCTCCTCCTGTCACAATCACGTGTTTTATTGCACCCCA
ACGGAAGGGTTGCATCCAACGTCGATCGCGGGTCACATCCGTTGATGAGATAGAACGGTGTATCACCACGGACTCGGTGGTGCGCTGTATTGATGGCGAA
GGGCAGTCGCTCGGCATACTCGTACCGCTCTTGTTCGTTCACATCGGTGAAATACATCTTGAGCGCCCTAGTCAATGTTTGTACCATCCGCAAGGCGTAG
TCATTGGCTTGAGGGCGATATGCCATTATAGCGCGTTATTTCTGACCGGCAATACGGTTGAATGCACAAAAGAAATCTGACATGAACCCGGGCTTGCGAT
CATGACGAATAAATTCACTCGCCCCAAATCGCCGGAAGACTCATTCTTCATACCCTACCGCGATTGTTTGGGAAGGCCTCGACGAGCTAGCCTTAGCAAT
CACGTAGCCAGAAAACAGACCAACCCACGTAAGCAACTCCGCGTTTCCTTTGAACGGCCATGGCAGGGAGGGGATATGATCCATCGCAATCATCTGAAAT
GAATACGTAGCTTGCATGTTTCCCGGATATTCTCCGTGTAGCACCGGACATCCCTTCCCGGTTTCACAATCGACACACTTCCCCACATAATGTTGCACTC
TTCGAAACAAACCTCTTCAATGAAAGTTAGATCGCACGAGGTGATACCTGCGGCCCACTCCTTGATGCCCCTTTCCAGTCTTGCATGGTAATGGTGTAGA
ATATCGTCCTGGAGCAATATCGAGATCACCAGACGAACAACTTCAGCACGATTAACGATACTTGTCGCCGATCGCGGGCAAAATACAACAATCCGCCTTC
ATCTACCACGTAGTCTAGGGCAATCACGGCACTTTCTTTTGCTTCCACGGTTCCCAACTTGGTTACATCTCTAAATAGGTAATGCTTGAGGTTAGCTATC
CATATTTTCTCGTCTTGCGCTGTTTTATGCGGTTGAGTCGCATCTGCTGTACCACTTCTCTCTGCATAATGGTTTACGCCTCACGTCTTCACATAGTCAA
TCGTGTGATCGACGCCATCTTCTTCACCTGATCACTACATACTAGAGTCAGTATGTGGCGTAATTGATTGATGGTGCACAGATCCAGGAGATCCTGCTCA
GTTAGCGTAATCATGCCTTGCTAGGCTGTATAGTGGTGTTAGCCAATCGATCTGTACTTTGATTCCAATCGCGCTTAACGTGTAAGAACTCATGTGTAGG
CCACGACTTGAGTTTATCTAAGGCCTTGTAATGCAACAATTATTCCCTGGTGCCTTGAAATCAATCTCGTCCCACATCTTCCTGATGACCAGGTTGGAAT
CACCACAGATGAAAACTTAAACTCTTTTCTGTTTCGCTAGCAGTTCGTAACTCAGCAGCAACCCGTAATATTTTGCCTCGTTAACCGTCAATCCAGTATC
GAATCGCGACGCGGCTGATAGTATTGTTCACTGGGGCAGTTTTCATATCACTGCGCTGTAAGAGATCTTTTTTTTTATCCGCAATATTACTGACCCGTCA
AAGCCGACGACCAGAAGCACTTCGCCATGCCTGACCGTAGGGGGAGGCATGCTGATGGTTTGTCCCGTTTGCTTCGTGTTGCGATCAACATCTCGTCCAC
CTCCTCTCGCGCGGCAATACTCGCCGCGAGGGTGCCGAGGATTTCGTCTTCCCCTCTTCTTACATCACTAATCTCCAACGTCCAAATCGACAGTAAAGTA
GGAAATCTCCCTAGTCTCCCATTGATACCCGATGACTGCATCAACCACGCCAAAGTAAAGTATCTCGTGAGCACCTAAATGTCCCGCGAGACCAAAAACG
TATTTCAAATATCCAATATCCTGAAGCAGGGCCAGTATTTCTTCTCTACTACTCCGTGGATAATTTCATTTGGTTTTAAGGTTCGACTTGGGAACATAAC
AGGTCAATTGTCTCTATCCTGTTTTGCAAAAAAGCTGCGATACCGCCCATTTGCAAGCATATACCACGGTAAATGGTCGGCCGTCCGGATCAAGATCTCT
GAGCACCGGGGTATGAGCTACTTCAGCCTTCAACATGGCGAACGCAATTATGGCTTTATCCCAACGATGATTACAAGTATGTTTTCCATCAGACTCTTTT
ACTTTGAATTTATCCTGACCATTCATTATCACCAGCTAATGATCGTCACCTGCATGCCACTGTTCGCGGTCGTCATAAATCTGGGTACTGCGGACGTGAT
TATAATTAGTTGAACAATCATTATCTATGTTGTGCAAACGCCCGGTCCCATGGAAATCAGCTTCTATCAATTCGTACAGGACGGAGGCGTATATGGAAAA
GTCTTCACTCAACCGGCTGTAGTAGTTCAGGCTTCCTAAGAAGGACTGTATTGACCGCAATGTCTGGGGAAAGGAATATTCCTTAACGACCCCAGATCCT
TCGGATCAGCTTCTATTCCATTTATTGACACTTGTTGCCCTAGGTACTCAACCTTACTTCATTCTCAAACACTGTTAGGTGTGCTTAGCAGAAAAGTCAA
TTGATCACATACTTCCAACAATCTGTCCACCTTTTGATAGAGAGACGTCCGGGATGACTCCGGAATTAGAATGTCATCAATGTAGGACCTCCGTCCTAAA
ACAAAAGGACGTTAATGCGGGTTTGGCTCGCCGTCTGTAAACACATCGACCGGTTTAGACGCCCCATGATCACTTGACTTCCGCCGATCGCCGATCGTAA
GATAACCATACAATGCGTTATCCACCATACGTTGATATATCTGCGGAGCATTCCTTAGCCCGAAAGACATGCGTAACCATTCATACAGACCCGAAGGCGT
AATAAAAACAGAGATCATTCGTGCTCGTTCCGTCATTTCTACCACCCAGAATTTGCTGGCCATATTCAGCGAACAATACCAAAGTGCTTTGTCTAGATCC
TGCAACAAGTCGCTGATCAAGGGCATGGGATATACCATCAGCCTCGTCAATTGGTTAACTCTTCGGTAGTCGATACACAGTCGTATATCCACTCCATTCT
TCTTCACGATCACTACGATCGGCGACTCCCATGGTGAAGCTGAGGTACACATGATTTTACCCGATAGTTACCCTTTGATCACGTCCGCCAACGTTTCGCG
GAACGTTGGGGCGACTGGACTTTCGTTGTGCGATTGGGGCTGATCCTCCGACATCTATATCGCAGATTACGCCTTGCGCAGCAGGTGGGAGGGAGTTTAC
TTTACCCATCAGTAGTTTTTCGTTTCTTCCAGATCAGCTGACGCAATTCTTCTTGTTCCTTGGTCAATGGGACCTCCGGCCGCCCACCTGTAAGTCGCCA
ATTTTCACCTCACCCAGCATCACATCTACTTCTGGTAAGACAGCCATATGTTGGCCAAAAATCCTCTGCGAACAACACTCCACTCCCATAATGATATGAT
AAGCAATCGTCCGCTCTTTCGCTTGTGATTGGTGTCATTTGGCCCCCTTGATGGTGGACGGTCGATGTTCCTCACATTCCTTACGGGTTATTACGTTTGC
GTGATGGGTGGGCCGGTCTTGCTCGCGATTAGAAACTCTTTCATTGTCCAGATCGGGAGTGAGTTCATCAAACAGCTTTGAGGCCGTGTTTCCTACTGAT
CTTGCATCATCTCAACGACGTTGTTCACATCGGTCATCACTGACTATCGCGTCGGTCGTCTTTCCTCGAGGTCACCTGGTTATTCAAATAGATCATGCTC
CGACTCCCGCACCACATCAACGTCACCACCGTCAATGGTTGCACCAGGTGTGCTGATCACGATGATAACCACCAGCGGCTATCCTGATTGTCGTTCTTAA
GATCATTTTTTTTGCCAGCGTAATCATATATTGACGCATCGCAATTTAGCATTGCTTCTTCTTCTAACCATGACCGATGCTTCTGTATCCTTCGACGGTC
GGTTTAAAATATACTTAGGTGTCGGGTATGACGGGTGTTCAACCGTAGGACTCAGCTATATCAGGCAATGCTTCTTCCTCCTCTTCAATGGTTGTTTTAA
ACACGAGTGTCTGCCACTCCTGATATCGCTGTGACCCTACGGAAACATACCCGGGTGATCGCGGTATCATAGCCGCCTAAAGGCATTATTTTAAGAGCGT
CCCTTGTTGGATGATCACCTCTTGATCGCTCAAATTTGTCAAGCGCAGGTAACCCAACCTTCCAGGTCCAGTCGTAGCCGTAGGTACCCAGCGTGAGTGA
CGTGTTAACCACAACTTTGACTGTAGTTTATACCGACCAACATTAACGTTTACAAATTTATCCACCGTAATCACCACTTACCTCTTGTCCGCGGCAATTT
ATTGTATCTCCGCTCCTCACTGCGGTCTTCTACCTAACAGTTGAATCCTGACCTCGTCCGGCAAACACACTGTCCCTTCATTATGATCAAGGCGTATCCC
GGCCGGTACTATAAAGTCCATTCCTAGAATCGGTTCTTGTTCCACTTGGTCACCGCCCTTTTATCGAATTTATAGACTAATTACCCATTCACATGATCTT
CACCTTCGTGAGGCCTTCATCCACGTATGAATTCTCTCCAATACACACACATTCCTGCTTCTGATTTTCATCTATGACAGCCAACCTTACAAGAAAAGGT
GGTGTCGATGATGGAGACTTCAGCCCCCGAGTCAAACAGTAGGATATCCTCCTCATTGTTGACTTTCCCCTGCTCTCTCTTGTCTGAACCACTTGTTTGG
AGTATGATACTTACAGGTGATTCGCCATGAAACAACTTGAGTTCCATCTTGGTGGGTTATCGTGCGTATTCATATGGTCGTCGCTCTACTTGCAATTGAA
GGCAAACAACTAGAATCCAAATCATATGTACTGAAAGTCCGGCCGGTCAGATGATTAACGCTTTTATAAACCCTTTCTCCTTCGTGTACTTCTCCACACG
CCGCGCACCCATAGAAACACTTGCCAGAGAAGTGACCTCGGCGTCCGCACTTCTGGCACGTCAATTATTTCCAGAATCCACGATCGTCATGTCTTTTCGA
CCCACAATGAGTGCACGACTTGTGTCCTACTGCACGATCCTGATCACCCAATCTTGGCTTGGTCAGACGTTTACTAGTTCGATCCGTCGTTTGATAGTCT
GCCGTAGCGATGTAAACACGTCGTCGTTCTTCGTCTGAGTCTGATCTGCATATATTATTCCGAAGAACTGCCATCTCCCCCACGTGGATTGTACGCACGA
ATCGGGCTGGTTTCGATGGTATCGGGATGTATGTTGAGGCTGATCGCTGGCGAAACTTGCTTGAGCCTGTCGGTGTGTTCCCTGTACGTTTCTGTTCCGT
TTGTACACACGCAAAATATCTCTTAATTTACCGACTCCTCCCAATCATAGCAGCGCTAGTCGGTTTGAGATCTCTATCATCCAGTGTCTCTATGAAGTGT
TCCACATGGCCGCGGCGATCAGCGGCATTTTCATCTTTCACATGAATTTTTGCTCGCATTCCAGCAACGTTCAGTCGATAGAGGTATTCCGACGGCGTTT
CATCAGCACGCTCACAGTCGTAGTAATATTGTCGACCAGCGGAAATGCCGTGACCACAGTATTGCAAAAGAAATCTCTAGATTAAATTGCTCCACTTTTT
GCGTGTCGATCGACTCATTTGAAAGTACCAGTTACGATCTACGCCCGTTAGCAGATCACCAAAAAGCAGACACTTCTCCGAGTCAGGGGCTTGGTCACGC
AGGAATGCTTACCTGACCTTGCGTATCCATCCTCTAGCACGGTCATCATCGTGATCGCGGCTCGAAAATTCTTTCAGCTTGGCAATCGCAGACATGCGCT
GCAAGGCGAATCTTCCTCCTGTTATGGCCTCAAATAGTATCCAACTGGGGTCGTCGTAGATCGTCGATATCGAGATCGTCAGGGTCGTACGAGTTGGCGC
GACTATGGTGTGAGTCTGCTGATTCCATGTCGGTGTCCGGCATACTCCCCCGAACACATTGTACTCGGGGGAGGGACGCCCGACATGCGCCGTACGGGTA
ATTCGACGGTGTTGGTCGTGTAAGAACTTCTACATGGCTTTTGCAAAGTAGATTTGCATCTGGTCGGATTTATCCATAGCAGGGACTTTCGTTGTAGGTG
AACCCATCGCAATCGTGGTCGGAGCGGTATGCTCTTGGTGGTCACGCGAAGGTGCTGCTCCAGAAGGTCCCAACGACATTCGTTTGATCTCCATGTCATC
GCTTTCACCCGCATCCGACTCAGCGGAGGCATAGTGCGACGACACAGCCGGAGGATGTTCTTCATCTTCGACCTTAACAGTGGTCGTGAGTTCACGGTCG
GCCGAATCATAATTACCGGTAAGTGGGACTATCATTTGGAACAGTGATCGATCGGCAGTGTTCACCCGATACAGGTTGCAGTCGATCAGATCCTAAACGT
CAAACGCCCCCGGTAAAACCCCTGCTCCTTGTAGCAACTGAATGAGATGTTTTACCGCTTCCATCTTTTTTATCGCGGCTCTTGGTTCAATCGCAGGGCC
TCGAATCGGTCCGATCAGCTCCGGTGTTGGGATCTTAAGCACCGGATCCGTGGACAGTAAGTCTTGAAGCTGGTTCCAGTGCAAACGTTGCTGTAGCTGA
TCAAGATCCCAGCCTTCCATATTGACCACTTCTTCTGCACTCATTTCATGATCATGGCTCTCAGATTCAGTCCTCCGTAACTTCTGAGCTGCAACTTTCG
ATCTTTTTTCGTTGTATATAGCTTTTTTAGACTAAACATGTCCTTCTTTAGCTGGACTCGTTCCGTCTAGAGAGTCGCACTTTGCACAGTGAGATCCGCG
GTGGTCCCCGAAGGGAAACTAGGAGGGCATATAGGTTTTTCTTTGTGACCACCTGGGTAATCTTCCTCTTTAATTTTCGTTTCACCAGAGCCCCTCCCAT
AACCCTGACAATTCGAGTAATTTAGATGATGACGTGTCTGCGACAATCGTTTCTTCGCCGACACTTCCATCCCCGGTAAAACCTTGACTTTCACATCTTC
GCTCTGGGATTCACGGTGAAAATCCCGAATCACCAAAAGATCCGGGCACGCGCACCTTTGTGATGGAGTGGAATTCGATCATTTTATGAAGCGTTCCCGA
CTCTCCACTGGCGCTTGGACGACCGACTATTGTAGGGGGTACTCCGGACCGTGTGTCTTGTCTTGTTCCTTCTCACCTTATGTACCCGTCGGCGGGAGGG
CTGCACTCTTCTG