Description :
From Genome Similarity Track
Location :
contig_8:466748- 468266
Transcript NameFunction/comments
g1634.t1hypothetical protein PHYSODRAFT_493134
g1635.t1hypothetical protein

Sequence
1518 bases(100 bases per row)
CACTCTAGCTCACGTTGAGTTTCGCCTTAATATCTAGGTGGCCTCCTTGAGACGCCCTGGGCACCCACAGCACCAGCGAGCCACCTCCTGTGCCAGGAAG
CCCAAAGAGACCCGGACGCCAGCGGTCGAGGTACAGCGTCTTGCCTCCCAGCGCGTGATATTGGACGTCCACTTGGCCTTGCCGCCCGCAGCGACATCCA
CCTCGTCTATTTTGTCTCCTCCAGACATGATGTTCACCGTGACGTCCTCCTCGTCCGTACTTTTAAAGTTGATAATGACTTGGCCGTCTCCTTTCTTGGT
CCACGACATGGAACTGCCTTTGAAGGCGTCTTGCAGCATATTCAAGCCCAGAGTGGCAGCTTCCGTGCCGTCGTCGATCTCGCCCATGAACTGGGTGGGG
CCGCACACCGTCTGGAGGTACTCGGAAAGCAGCAGCGTGAGGCGCGTGGGGTCGACCAGCATGGCGGCGACTGCGGAGAGGCCAGTGTCGATCACTTGTA
CGCAGTCTGCTTCTCGTCCAACGAGGTGCCGTTGTCGCTTTTCCCGGACTCGATGAGATCGTTGATGATCACTCCGAAGGTCTTTCGCAGTGTTTCGCGC
GTTGTGTAGGCGGTCGCTTGGCTGGATTCGGAGACCATTTGCTTCATACAGTTGTTGGTCACAGTGGGGACGTCGTACAGTACCAGGTCAGACTCGCTGA
CTTTCAAGCGAATTTCATCGTCCGTGATGGCGGGGTCGTCTCGTCGATATTCGTTTACAGTCATCCAGACCCGGTCGGTTAGAGACTTTAGGTCGCCGCC
ACACGAAGAGTTCTGCTTCATTGCTGTCTCCAGTGACTTAATCTCGCCTTCCGTGATCTCTTCAGCGGCCGCCGTGAAGTTGGCCCCCTTCATGAAGGCA
CGGAACTTCTGCCAGTTCATCAGGATGTCATCGTCGTTGGCAAGCACTTGCATCAACATCCATTGAGCCGTGCCCATCACGTATTGTGACAGCCTCAGAT
TTGGAGGCACGGCCTTGCCCATGCAAACGTAGATGGCGATAGGTAAATCCGTGACTACCGTACCCGTCTGGTACAGCAGCAGGAGCAGCTTGCGATCCGT
GGCTTGCGGGTCCTCCACCTTCATATTGCGGACGTATTTGATGATGCCTCTCATCACGAGCATGAGCGAGTTGGAGCACCGGACGGCCCAAGAAATCGTC
TGCCCCAGCTTGGCCAGCTCGCCGAAAACGCCCATCGTCGCAGTACTGAAGATGGACATGGCTACAGCGGAGACCTTGTTGGCCACTTCGATGCCGCAGT
CGCTGTTCTGCTGGATACATTCCGCGCCGCACTCGACTGGGTAGTCCATCGGACACTCCGTCCAACAAGTGTTGGTCGCGTCATTGCGATCGTAGTTGCT
CGGACACATATCCATGACGTGCGCTTCTCGGTAGCACGCGGCGTCCGGTGAAATACTCCAGGGGCCTACCCAGTTGCGGTACGTCGACCGGATTGTGCTC
GTGGCCGTGGCGGGGGTA