Description :
From Genome Similarity Track
Location :
contig_138:46662- 48109
Transcript NameFunction/comments
g13714.t1XP_008907341.1 hypothetical protein PPTG_13423 [Phytophthora parasitica INRA-310

Sequence
1447 bases(100 bases per row)
CATCACGTGGCTCGATTTGACCCAGGAGGTTACTTTCCTGCGCAATGGGCCTTCAAGACAGCTGAATCGCAACTGATAAACAGCATCGTGCAGATTCGCC
GCATCATAGACAAACAGCAGATGAACGCTTGCACCTTCGTTGATAAACGGCAATGGGTGCCCAACCACGAGCGCCTACATTGCGCCGTTTGCAGCCGGAC
TTTCGGTACCTTCCGCCCGCGCCATCACTGCCGAAGCTGCGGTGAGGTTATCTGCGGAAAATGCAGTGTGTTCAAGTCTGTGGAAGTGCCGGGCACCACA
CTCAAGAACGTTCGCATTTGCTCTGTGTGCAACATGGGCGTACAAAAGGCTAGCGGGCATGAGGACGGGAACATGTCGGATATATCTACCTCCTCCGTTA
CTTCGAGCAGCACAGTCGCTCACAACGAGATGAACCTGATGGATCTTTACATGGGCGCCGGCGGTGGACCACGCACGCCCTCAGCCTATTCAGACGCGTC
GGCGCAGTCTAATCTCTCTATCCGGTCGACGACTTCCACACGGTCCGTCTACGATGCTCGCGGGCGAGCGCACAGTCACGCTCGAGGTACTCGGACTCCC
CGTGCCTTCTTCAACGAAAGCACCACACCACGATCGTACATCGCCAACAATCTGACGCCTCGCAGCACACGCGGTTTCGGCTTTGGCTCTGGGTCCACGA
CGCCTCGATCCGGAGCGAACAGCGCAGCTACGACCCCCTTGGGCGGCGCGAGGCCATCCATTTCTGCGGCAAGCGTGGTGGCAGCTGCTGCTATCACTGC
GCATCGCCTGTCGAGCTACAAGCAACACCCAGTTGACATCGGATACTTGCGCGATTCGGTACATGAAACCCAACCAACAGCATTAGCACCTCGTGAACGG
CCAGAAGATCCGTCGACGCCGTGGCCTCCTGTCAAGATGCAACGGCTGGAGACGGGGGAGACAGCGGACGTGGACATGGAAGCGGATGAACAGGAAGATG
TAGAGGCAAAACCAGCAGCGCCGCTGGGGATGCAGCTGCCGACCGTGGGGCGCATCTCGGAGAGTCCGTTCGAGCAGTCGACCCGTGCGTCGTCCGCTTT
GCGCGTGAGCATGGACAAGGAGGAGCCTGGGAACATCGACGACGCGGACAGCGGTGCGATCGCCCCGAGCAGCGGGTTCCGGCCGTTCCTTAACGGGATC
CTGTCGCGCGTCCGCGGCGAGTCGGGCGAGAAGTCCTCGCAGCGGGCCTCCTAATGGGCACCGGCAACGGAGAGACCTTACCCTCGTCGAAGAGCCCCGC
GAAGCAGCAGCAGCAGCAGCAGCACACGCACAGGCAGCAGCCCAAGCTCAGACTGAGCAGCCACATCGCCCCTGCGCCGCGAAAGCCTTCAGGAGGGCGA
ATGCGTCTGCTCGCGAGGAATCCTCACAATGAGACGGCGAGAAGCAG