Description :
From Genome Similarity Track
Location :
contig_3:46661- 47664
Transcript NameFunction/comments
g885.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
TCTGTGCTTCTGGCACTTACTGAGGTCGGGTTTCGAGTGGCAAAAACCTTGTTCGTAACGAGAAGTGCTCGCCGCATCCTAGCTCGACGCCAACTTCCTC
GACCAACACGTGTCTTACGGATACAAGACACACCGACACAAGAAATCTCTCCGATGCCGTGGCTACAAGACGTGTTTCGAGCCCACGAAATAATGGCCCT
CCATTCGGCGGAGACCTACGCCGACATGAGCGCCGAATACATCGCTATGGGTTGCTCCTACGCCATTCTTTTCTTCTTTGGTTCCCATCCAAAGTTCACG
CTTGGCACCCAGAGTGTAGACATCACTACTATCGTCCTCCAGGTGCTGATCGAACTCGTTGTAGACTTTGTGGCGAGCTCGTTCGAAATCCACCACAATG
TCAACTTCGACCACATCAACTCCGACACCGCCTATCTGTCGTTCTTCTCGGCGGTTGTTGCTGCAGCGAACATTCACATCTCGTCTGGCATCTACTTGAA
TCCTCAGTGAGACGCTGAGTTCCGAGGAAGAAGCTTTCGTAATGTAACAATGTTGAAAAATGTTTTAATGGTACAATGGAAGCGCTTCTTATCGTTCTCG
ACTCTAATAAGCTGACTCAACTGCAGATTCTTTCAAGAGCAAGCGCTCAATCCACGCGAACTCCTGTTTCTGTGTGTTGTCATCGGTTGAGGTATTTTCC
TGGTCGTGGGAGACCTGATGGCGCGACGCCCACACCATCGCACACGTCAGGTTTCGTCGGTCCTCAGCAAAAATGTCCGCTTGGTGTTGCAGTAGTTCGT
GCCAGATAGCCATATTTGACGCATATCCTCGAGCTAGCACGTGCAGCAGGGTCTCCTGCTGGTTGTTACGTGCTCGAGCGTCGGCTCTGTGTGCAAGTAG
AAGCTTCACAACGGAGTCAAACTCGTTGCGCACAGCACCAAACAACGCCGAGTCGCCGTCGTTATTCACCGCATTGACCTCAGCACCGTGCAGCATCAGC
AAC