Description :
From Genome Similarity Track
Location :
Scaffold_1182:4666- 5761
Transcript NameFunction/comments
Phyta_totarag12318hypothetical protein PHYSODRAFT_565187

Sequence
1095 bases(100 bases per row)
agccgtcgctgcttcgtgaCCGACTGACTAAAAATGAGTCAATAGCACTGCTTCGGTCCAGACGTAGCAACTCCGTTCACTGCTAAGATACATGAATTAG
CCCTCGAAACAAAAGCTATCAAAgtagcaacaacagcagcaacagcaacaacagtcaCGAACAAGTTGTTCAGCACTGCTGGGCGTGTCGTTTCGCGCGC
GACCTAGCCCGGTTAGGTAATGGCACTGATACACCTTTCATCCAATCATCGAGTTTTCTCTACTTCCgctctgtgattggccaaaacgcTGCTTCGCGTC
CCATTTTGTGCAAAGAgcgagaaggaagagaacAATCAGTATTATCAAGTGTGAGATAGAGCAGAAAGCGAGGAAGGCATGGCAGACGCAGGAAACAGCA
AGGCGCGcgaggtgaaggtggtgctgctgggcgacaCGGGCGTGGGCAAGTCctcgctggtgctgcgcttcgtgaCCAACAACTTCCGCCCGTACTCAGA
GTCCACCATCGGCGCCTCCTTCATGTCCAAGATGATCGTGGTCAACGACACGCCCATCAAGTATCAGATTTGGGATACCGCCGGCCAGGAAAAGGTGAAA
AATGGCAACAGTGTCTCTCTGCCACATACAATAGTGGGAACCTGACAAATGCTGCCGTTACTCTTTTTCTTTCCTTTCCTTTGACAAAATCTGTGATGAA
AACTTACAGTACCACAGCCTGGCACCCATGTACTACCgaggagctgccgccgccatcgtAGTGTACGATATCACTAGAAAGGTGCGTCGTGTATATTTAT
GGTTTCTCATAGTTGATATCCATTGATCTAACTacttttttcttctttttttcttgctgcagcaatcgCTGACAACACTGAAGAACTgggtgaaggagct
gaagcagttgggTCCAGACAATATCGTCATCGCCATTGCCGGCAACAAGAGTGAtctggaggagaagcgcgAGGTGCCGGCGTCTCAAGCTCGAGCGTAC
GCCGAGGAGATCGGCGCGCTGTTTATCGAGACGAGCGCCAAGGAGGATACGAACGTGTCGGACCTGTTTATCCAGATCAGTCAGGCGCTGCCTAC