Description :
From Genome Similarity Track
Location :
Scaffold_17:46654- 47753
Transcript NameFunction/comments
Physo_131669hypothetical protein

Sequence
1099 bases(100 bases per row)
ATCCCATGCGTCTTGGTGCCTTGCAGGTAGCGAAAGATACGCTTGACCGCAACCCAGTGTTCCTCTTGGGGGTTCTCCATGAAGCGCGATACATAGCCAA
CGGCGTACGCGATGTCTGGGCGCGTGGCGGTCATCAGGTGCATCAGAGCACCAACAGCTTCGCGAAACGGAGCGTTCACCTTGGTCGCCGCGTCGCTTGG
AACCAGTCGAGTGCTCATGTTCACCCGACTCACCACGGCCTTGCACTCGTCCATGGCGAAGCGCTTCAGGATGTCGTCCACGTATCGCCGCTGGCACATG
GTCACGCTGCCGTCCGGGCCGTCCACCAACTCGATCCCAAGAACAAACGCGCACTTGCCGCTGTCGGTCATCTCGAAGCGCGTCTTCAGGTCGGTCTTCG
TGCGTGCGATCAGCTCGGGCGAACTCCCGGTAATCAGTACGTCATCCACGTACACCAGTACAAGCACGCAGTGACCGTCCACCACCTTGATGTAGAGGCA
CGGATCGAAGGCCGACACTTGGAAGCCGATGGAGCCCACGAACTCGTCGAAGGTCTCGTTCCACACTCGCGAAGCTTGCTTGAGACCGTAGATGGCCTTC
ACCAGTTCCAGGCAGTCGAAGTCACCATCCAGTTCGACGCCTTCCGGAACCACGCAGAAGACCACCTCCTTCATTATCCCGTACAGGAATGCTGTCACCA
CGTCGAGTTGGTCGAGGGGCCAGCCAAAATACTTAGCAATCGCGATCACCATGCGCAGCGTCACATACTTGACCACGGGCGAGAACGTCTCGGTGTAGTC
AATGCCGTACTTCTGCTTGAAGCCCTTGGCCACGAGGCGCGCCTTGTACTTCTCGATCGAGCCGTCCGCTTTGCGCTTGATCTTGAACACCCACTTGGTA
TCGATGGCGCGTTGTCCGTTAGGCAACTTGGCAGCTCGAAACACACCACGCAGTCGCATCGACTTGAGCTCCGCGCGGATCCCTTTGCGCCAGTGCACTT
GATCAGGACCGTTCACAGCCTCTTGGAACGTCGTCGGCTCCGATAGATCGGCTGCTGCTTCCACAGCGTTGGCACTGGCACGCCAAAACACTGGAGGCG