Description :
From Genome Similarity Track
Location :
contig_138:46654- 47655
Transcript NameFunction/comments
g14237.t1OWZ11412.1 hypothetical protein PHMEG_00015570 [Phytophthora megakarya

Sequence
1001 bases(100 bases per row)
CTCGATTTGACCCAGGAGGTTACTTTCCTGCGCAATGGGCCTTCAAGACAGCTGAATCGCAACTGATAAACAGCATCGTGCAGATTCGCCGCATCATAGA
CAAACAGCAGATGAACGCTTGCACCTTCGTTGATAAACGGCAATGGGTGCCCAACCACGAGCGCCTACATTGCGCCGTTTGCAGCCGGACTTTCGGTACC
TTCCGCCCGCGCCATCACTGCCGAAGCTGCGGTGAGGTTATCTGCGGAAAATGCAGTGTGTTCAAGTCTGTGGAAGTGCCGGGCACCACACTCAAGAACG
TTCGCATTTGCTCTGTGTGCAACATGGGCGTACAAAAGGCTAGCGGGCATGAGGACGGGAACATGTCGGATATATCTACCTCCTCCGTTACTTCGAGCAG
CACAGTCGCTCACAACGAGATGAACCTGATGGATCTTTACATGGGCGCCGGCGGTGGACCACGCACGCCCTCAGCCTATTCAGACGCGTCGGCGCAGTCT
AATCTCTCTATCCGGTCGACGACTTCCACACGGTCCGTCTACGATGCTCGAGGGCGAGCGCACAGTCACGCTCGAGGTACTCGGACTCCCCGTGCCTTTT
TCAACGAAAGCACCACACCACGATCGTACATCGCCAACAATCTGACGCCTCGCAGCACACGCGGTTTCGGCTTTGGCTCTGGGTCCACGACGCCTCGATC
CGGAGCGAACAGCGCAGCTACGACCCCCTTGGGCGGCGCGAGGCCATCCATTTCTGCGGCAAGCGTGGTGGCAGCTGCTGCTATCACTGCGCATCGCCTG
TCGAGCTACAAGCAACACCCAGTTGACATCGGATACTTGCGCGATTCGGTGCATGAAACCCAACCAACAGCATTAGCACCTCGTGAACGGCCAGAAGATC
CGTCGACGCCGTGGCCTCCTGTCAAGATGCAACGGCTGGAGACGGGGGAGACAGCGGACGTGGACATGGAAGCGGATGAACAGGAAGATGTAGAGGTAAA
A