Description :
From Genome Similarity Track
Location :
contig_3:46652- 47655
Transcript NameFunction/comments
g816.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
GACGCTCGTTGGCTCTGTGCTTCTGGCACTTACTGAGGTCGGGTTTCGAGTGGCAAAAACCTTGTTCGTAACGAGAAGTGCTCGCCGCATCCTAGCTCGA
CGCCAACTTCCTCGACCAACACGTGTCTTACGGATACAAGACACACCGACACAAGAAATCTCTCCGATGCCGTGGCTACAAGACGTGTTTCGAGCCCACG
AAATAATGGCCCTCCATTCGGCAGAGACCTACGCCGACATGAGCGCCGAATACATCGCTATGGGTTGCTCCTACGCCATTCTTTTCTTCTTTGGTTCCCA
TCCAAAGTTCACGCTTGGCACCCAGAGTGTAGACATCACTACTATCGTCCTCCAGGTGCTGATCGAACTCGTTGTAGACTTTGTGGCGAGCTCGTTCGAA
ATCCACCACAATGTCAACTTCGACCACATCAACTCCGACACCGCCTATCTGTCGTTCTTCTCGGCGGTTGTTGCTGCAGCGAACATTCACATCTCGTCTG
GCATCTACTTGAATCCTCAGTGAGACGCTGAGTTCCGAGGAAGAAGCTTTCGTAATGTAACAATGTTGAAAAATGTTTTAATGGTACAATGGAAGCGCTT
CTTATCGTTCTCGACTCTAATAAGCTGACTCAACTGCAGATTCTTTCAAGAGCAAGCGCTCAATCCACGCGAACTCCTGTTTCTGTGTGTTGTCATCGGT
TGAGGTATTTTCCTGGTCGTGGGAGACCTGATGGCGCGACGCCCACACCATCGCACACGTCAGGTTTCGTCGGTCCTCAGCAAAAATGTCCGCTTGGTGT
TGCAGTAGTTCGTGCCAGATAGCCATATTTGACGCATATCCTCGAGCTAGCACGTGCAGCAGGGTCTCCTGCTGGTTGTTACGTGCTCGAGCGTCGGCTC
TGTGTGCAAGTAGAAGCTTCACAACGGAGTCAAACTCGTTGCGCACAGCACCAAACAACGCCGAGTCGCCGTCGTTATTCACCGCATTGACCTCAGCACC
GTG