Description :
From Genome Similarity Track
Location :
scaffold_161:4665- 7129
Transcript NameFunction/comments
g7398.t1hypothetical protein

Sequence
2464 bases(100 bases per row)
CCCGACGTGACGTTCGACGTGCAACCCACCATACTAAGACCAAGTCAACCTGAATGCGAGTGCGCGGACACGACGAAGGAGACCGCCAAGAATCCAGTAG
ACCAAGTCAGACAGAAGAAGAAGATAGTGATAAGAAGAAAACAGAGTTTGTTTTGCGTTGGAAGTGAGAAGTGGTGCCTTGTCGGCCCCCTTGCTTTGAG
CGTACTGCGTTGAGGAAGACTGCTGCGACCTATAGCGACTACTACGAGGCTGCGACCCGGGAGCGCTGGCGTATCGGACGACCAAGACCGCACGAAGATC
GAGGAACCCGTGCGAAAACTCTCACCTAAGTCTAAGTCCCATTTAGGTGGGGACCAGGAACTCGTATCCCTGGATTGATCCGCCTATTTCATTTGTCAGT
TGACTGTGGTTGCTTTAGAGTGACTGCTTTCATTTCATATTCACCTACGATTCGGGAGGTTATTAGCAATCCCCCCTGGATTTTGATAGTAGATTGCTGT
GTGGTTCGAAGGAACTTGTATATTTCTCCCATCCGGGAGTGGTGCGCGGAGGCATCCCGAATTTACCTGTATTCGGGACTGTAACTCAGTCGGACAGGCT
GTATATTGTGAGTGTATAACAAACTCTGTTGTTGTTTCTGTATTGCTTTTGGTTATATTGGAGAAGGTCTTTGTTCGTGACCCCACTCCCAGCCAAGACA
CTCCGGACTGTTAGAGTCTGGTAGTCTCTCTACATATCTACGTATCCTGATCGAAGAACATCCCAAAGGTCAAAGCCCGGTCCGTCGAAGATAAACGACA
CCGATAGGGATTACTTCAAGGTCACACGCCAAATCTCGGGGCAGACACTAGTTGTCTGCATTCGGGATTCTGACCCCGGCATCCGGACGCTCCCTCCTAG
AGGAACGGGTACTCCCCGAAGCGTTCGGGTCGTCTGAGTTCTCGAAGCTCGTTCGTCTGCCGGCACGACTGTACACCCTGGACGATAAAGGCGTTCACCC
GCCTCGCCTCAGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCTGTCGCTCCATTGATGGAACGAATGCGCGTAGCTCTTCATGGT
GTCAACCAACACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGTGGGTGATCCGCAGGCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCT
TGCCAGAACCGCGCTGTAAAGCGCGGACCCCGATCCGACACGATGTCGAGTGGTGTCTAAACACCATGTCAACAAACAGACATGCCGTCTGTTTGGCTGT
CACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAA
ACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCT
CGCAGGCACGAACGTACTTGCGTACCCATTTGTACTGGTGACTCCAGTAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGA
TGTCGGGGCATCGTGGTACTCGTACGTGATCTTGATCTTCAACTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGC
AGCAGACCATTGTGTACACGATAACGGTGTACACGAGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAAGTGTGGAGAAGTACTCCAACA
ACTGCTTCGCATCCGCATCATGCGCGTGTGCGGCCTTCACGTCATCCAACAAGGACGACGAGGGAATAGTCGGCCTCTTGCACCGTATAACCTGGTCGAC
GCGAAAGCACGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGA
TATGTGCGGCGACTTGACCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCA
TACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTACGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGT
GATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGACACCGCCAAGATCGGCGCCTC
AGTCAAGCCCTGCTTGACCGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTG
CCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCT