Description :
From Genome Similarity Track
Location :
Scaffold_23:466427- 468469
Sequence
2042 bases(100 bases per row)
AGCTCCCACCAGATCGAGGCGTACGGCATGAGATCGATCTCGTGCCTGGCACAAAGTCCTGTGTCACGAGACAATGGCCTCTTCCGCGCGAACAGTGCGA
GGTCATTGATGCCTTCTTCGCTGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCCCTCGACGCCAACTTTCTGCGTTCGGAAGCCGAAC
GGAAAGTGGCATCTAGTTCACGCTTATAACAAGCTGAACAACGCGACGGTGCCGGTCCAAACACCAATCCCGCGAAAGGATGTGTTGTTGAACAACATGA
CCGGTAGCGTACTTTTCAGTGCGCTGGATTTGGTAGACGGATACTACCAGATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTGAGCACTCCAAG
CGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGTGACGTTCAACCACCTGGTGACGCAATTGTTCCGCCCTTTGCGTACC
TTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGAAGGCAAGACGGCCATGGAGGTGCATCTGGGGTACCCCCGTCGAGTGCTGG
ACGTAATGCGAGCGAACAAGTTCTACGCCAACATCGACAAGTGCGTCTTCGCGTCACCAGAGATTAAGGGTCTCGGTTGCTTCGTAAGCAACGTGGGCGT
TCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCAACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCAC
AAGTACAGTGCAGGGTACACGGGCTTCGCTGAGCCCTTGTCGGGCCTCCTTAAGAAGGGCGTCGGCTGACGCTGGGAGCAGGAGCACCAGGATGCCTTTG
ACAGAATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGACCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGACTGTGCCATCGG
TTGTGCACTGCTGCAGGCCGACACGGCTGGACATGTACGAGTTATATCGTTCCAGTCCAGGCAGCTCAAATCCGCCGAACAGAACTACCCTGTCCACGCC
AAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCCCGGCCCTTCGTGATCTACACAGACCACGCGTCCTTGAGGA
CGGCGACTAACTCGCCTCACCTCTCCCAAAAGATGGGGACGTGGCTGTCCTACTTCGCGGAGTACAACTTCCGCGTCGAATACAAGCCGGGCAAACTCAA
CGTGCTTGCGGACGCCCTCTCTCGGCGTCCAGACTACGAGTTGGCCCACATCACACGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGG
GACGATGAGGCTGTCGCGCCTATCGTCAAGTTCTCTACGGCAGGAACGAGCGCGAAGTCCGATTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGAT
ATGAGTTGAAGGATGGCCTCCTCTATTACCGAGTGGAACCCAATGAGCCTCCACGGGTGGTCGTACCCAACGACAAGGATCTGACGTTCGACATTCTCGC
GGTGGCGCACGACGCGCCCTCCAGAGGCCGCTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGGCCTTCTGGTGGACCGACATGTACAAGTGGGTC
GCCCGATCCATGACGGCATATGAAACATGTCAGCGGGTATAACCCGCAAGGCACGCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGA
AGTTGATGAGTCTTGACTTCATCTTTGGGCTTCCCACCGACGGACACGGAAACACCAGAATTTTTGTGTTCGTGTGTCGGCTGAGCAAGATGGGACATCT
TGTTCCGGTCCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTTTTCGTCGATGGCGTGCTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGAC
CGAGACCCGCGGTTCACGGCTGCGTTTTGGAAAACGCTGTTT