Description :
From Genome Similarity Track
Location :
Scaffold_776:4664- 6687
Transcript NameFunction/comments
Phymu_g11932hypothetical protein PHYSODRAFT_323276

Sequence
2023 bases(100 bases per row)
ACCATTCGTTCGCGATCGAAAATGCCAGGCTTCTTCACCTCATTGGGCTTCAGGCAACGAACATAGTGAGCTTCGGTGCGTCCAATCTGAACAATAAGAC
GGTCTAGCTGACTTTTAAACTGCGCTGATACGCTAGGTGCGCGTAGCATCGAGTAACGTCTCCGTCCGGCCGTTCCGTTTTCATCTGGCGAGTCAACATT
CTCATCAGCTCCAATAGCCACCACCACTTCATTATCCGAAGACGAAAGGATGTTGCTCGCGTCGGTGGGTAATGCGTCCGTATTCTTCTCGACAAACTGC
TCCACATTGTAGCACACACGGCCAGCAAAGTGGTGAACCACGAACTGGTGTTCCACGCGCTCCATCTTGGACGCCGAAAATGGGTGTTTCTTGGTATCAT
GGTgcacagcttcttcttgagaTTCACTTCGGTGCAAGTACCGGCTGAAGGAAGACATGAACAGTGGTAGAGTGTTCTGAGcaagctgtggctgctgaag
cagtcCTGCCGAGTCCGGAGAACCCTCCGCGCCGTGATAGCGGTAAAACTTGGTGCTTAAAGCTTGGTTTGAACCCTTCGGCATCAAACATTCCTGATCC
AGCAATGAAAACAGACCGTTGCTTTTGTCATCGAAAAGAGTCAAACACGCCGCGTTACTTGGGTACGAGATGTTCCTCCAGTCAATCCCCTCTGCAATAT
ATACCTGCTGCTCGCGCACAAAAACGAACTCGTTGAACTGTGCTTGAAGTCGCTCGTTGGCGTAGTTGATGCAGAGCTGCTCAAATCCATTGCGGTTCAA
GCTCTCAAAGCCAAAGATATCCAAAATACCAATACTAGCCAattcttcgtcttcgtccgaaATCGAAATGGCCGAGTCGTAATAATTGATTTCGTCACTG
AGCCGACGTACAAGCCATGTAAAAAGACGACCGTAGATAGCCTTAGCAAGTGATCGGCAGATTTCCTTGGCCTGTTCCGGATTGTGTTTGAGTTCCATAA
CCTCCATACCAGCCTTGATCTCTCTGCTACTCAACAACTTTTCAAGCTTGGTCACATCCACACCGATGAGCTCAGCACATTTTTCCAAATGAAAGCGGGA
CGCAGCCGTAACAGCAGTGGCATCTTCCTGCCCGCCAGCAGCGGTAAAGTTCACGTTTCCAAGATGTAGCAACGCTGCCAAAATCTTGAAAATATCCAGC
CGTTCCTGCTCGCCAACGCCCGTGTCCTCGAACGCTCGAACTGTTTCCACGTACAATTGCGCATACTTATCTGCCACAGCCCGTTTCCGCGCAAAACTGG
GTCCGTACGAGTTGAGCAGCTCATATTTGCCTCCTTTCCGGAGTCCCAGCGTGTCtagcagctccttgtctgctccttcgagcagctcatAGAAAATGTG
GAAACTGCGTTCCTCCGGGttctggtgcagcagcctcaccttctccagcaaatAGCTCACGATCTGTGCCCCGACAATCTCGTTCTTTTCTCCGAACTGG
ATTTTGATAAATTTGCCAAAGCGACTCGAATTGTCGTTCCTGATAGTCTGTGCGTTGCCAAAAGATTCCAAAATCGGGTTGGTTTGCAGGATCCGCCTGC
CAATTTCCACGGCGCCGCTTCCTTCCTGCTCTGTTTGCGACTGATCTCTGCCCACACTGGTCAAAAACTGCATGAGGAACTTGGTGCTCTCGGttttgcc
actgccactCTCTCCACTGACCAAGATGCTCTGATTGCGTCGTTCGGGCTTCAACAAGCCACCGAAAGCTTTGCCACCGATGGCATACACGTGTGGCGGC
AACTCTTCTCTCGCGGATGAGCTTGGGTTTGTCATAACCTGTTTATACGCGTTTAATTGCGCCTCCGAGTACAGCTTTGGGAGTGGTTTCAGCGGGTTCA
AGGCCACGAGAATGTCCCCAATGGAAGTGTAAATCTTGTCGTGATCGAAGCGCTCGCTTAGCGCCTGTAGCAACGCGGCTTCGTGAAGGTGCTCGAGGCT
CGTAAGGCTCGACATGGCAGGGA