Description :
From Genome Similarity Track
Location :
Scaffold_26:46630- 53993
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009541Similar to PKAR: cAMP-dependent protein kinase regulatory subunit (Ustilago maydis)
Pytul_DAOMBR144PYU1_G009540Protein of unknown function
Pytul_DAOMBR144PYU1_G009539Similar to UBE3C: Ubiquitin-protein ligase E3C (Homo sapiens)

Sequence
7363 bases(100 bases per row)
TGATGGTGGTGGCCGAGATGCGCGCGCGCTTTCTTGATGGCGTCTTTGCGCGCCTTCCACGTGCTGCGGTAGCTAGCGTACCCGCTGTTCATGACGACTT
CAAGCGCTTGCTCCAGGTCTGAGTTCTTGGCATCGAATCGCTCTAGGTCAGCGAGCGGGATCCAGTCGAACAGCGGGACAATGTAGAGCGACGTCGCGGT
CAGTGTCGACGCGACCATCTGCTTCGCAAATCGAACGGCACTCTGTGGCGTCGGGAAGCATTGGTACACGTGAACGGTGACGTTCTCGATCACTTTCGGT
GGTACTTGGAGCAGGACGCTCACGCACGCGAACCGCTGGCCATTGCCGTGAACCATATCGCCAGCTCGGAACTGATACGCTGTCGGTGGTGCTGCTGATG
CTGGCGAGGTGTCGGATTCTGTCGACTCTGTGGAGAAGAAATTTTCCAGCACCATTGTCACTTCGTCCTCCTTGTAGATCGCGAATCGTGTCGTGTCTTT
CTCTGGCGGCGGCACTTTCTCCAACCCACAGATGTGGCGAAAGATGAGCAACGTCTCGTTTAGGTCGCGAAACTTGCCAAATACGCGGAACGCACTGATG
ATCTTCTCACCTTGCAAAATGGTGTAATTTGTGCCAGAAGTGCTATGGTTGCTGGTGGTAGTGCCTGCTTTTCGGGAGTCGGCCGATTTGTGGCTTCGTA
GTCTGCTAGCAGTGGGTGAGGGATTTCTGCAATTGGTCTCTTGCATGAACCCAAGCAGACTGAATGGCTGGCAAACTCCGTGAACTGGATTCCAGATCGC
CGTCGCGGACGTGGCTGTGGGCATCTTTATTGCAAGCATCGTGTTGTCCGATGCCGCCTTTTCTATCCTGGCTGCTGCTTGCACGCTTTTCTGACGATCG
TTGTAGCACGAGGCGATGGAGGCGTCATGAAGCGGCTTGTCGTGGTAGCTTGGAGGTAGCGCACCGTCAGTCGGGTTGAGACTTGCAAGAGTTCTGCTGC
GCGCTAGACGCAACGGGTTCTGCGCGGACACGATCGATTTCCTTCGTTCTGCTGGGCTCACTTCTTTTTTCCCATTGCTGGAAACCTGCGGTTCTTGCAC
TTTCACGTTGGTGTCACCATCAACGCTAAGCTTTTTCAGGTTGTCCACGGCGAGTTGCAATTCGGGGGTCAGAAAGCTATCATTGAGGGAATGTATTCGA
GACACCTTTGGCTTCGGAGGACTCTCTGGCGCAGAAGTCTCCATGCCATCGTCGTCTTCTTTCACTGGGTTCATCCCTGCATCAGAGTGTCGACGAGGGC
GATCTTCACTAAGAATATCCCAATCTACCACTTTCTCCAGCACGTTTGGTTTGGGCAACTTTGAGATACTTGGTTGTTTAACACTGGGACTTGCGTGTTC
CGGCGTTCTTCCAGCGAGCTGCTCATCAAAACTGTATTTCGCTCGGCGATGCTCCAACACCAGACACCCTGGCTCGACCACTTGTTTCACTGTTCTCTCG
ATGCGCAACACTGGTGTCGATGTTGATTTTAGGAGATTTGATGGCCCTCGATCGCTTCCGATGCCGTTCTTTTGCTTTGACGCCATGAAATCCTCCAGAA
ACTTTTTTCGGTACTTTTCCCAGGCAACACTCTTCAACGCGCGGCTCTCGATGCTTTCTCGAATATAACCAGCTGCAGAACGCTGCAGACTTTCGCGAGC
CTCTGGCGACATGAGATGAAAGATATCGAAGCGAGAGAGGACGAGAAGCTTCACTGGCGACTCGGCATACACAGAGTAGTCTCGGACGTGAATGTCGTTA
AACTTGCCTGCAGACGCTCTAAACAAAATCAAAAACAAACGTAAGAGAGGCAGCCATGGGAATGGTACGGAAAAGACAACGCACGCACACACACATAAAA
AGTGAACGTACTCAGCACAACCGATAATGGAGTTAGGTCCAAACCGACCCAGCTCGTAAAGCTGCGACTCACTTGTGATGGGGTGTTTGCCTTCGTGGAT
CATCACGCACTCGCCTCGTGTGACGATAAACATCTCGGATGCTCGTGAGCCCTACATACAAACAATCAGTCCTTGCAAACATAAATCACCTTCATCCTCA
TATTTGTATGAACCGCTCACCTGTTTACAAATTTCACCCCGGAATGGAAAGTATTTCTCTGTCATGACCGAGCACATGCCTTCAATGGTGTTATCGTCCC
ACTCGGAGCCAATGAAGTAGGCATTCTTTCGCAACAGGTGCGCGTACTGCGCGTGATACTCGTTCTGGTATTTCTTGATCAATGGTTCGTATTGATCACG
ACTCAGCACCAGTAGCTCGCAATAGTCTACGCACATGACCGTCGCACGACGGATCCCATCGGATTCTGAAAGCGCGAGCTCGCCAAAGCACTCCCCCTCA
CCCAATCGAGAAACTACGTTCTCGGATGTTTCTCCGAAGCGATCTTTTGATCGCACAGTGACTTCGACACTTCCAGAGAAGATGATGTAGAAATGCTTCC
CAACTTGACCCTCCTCAAACAGCACCGTGTTGGTGACGGCACTGATGAGCCGCATCGCTTTGCACAACTGCTTTCGCACTTCGAAGGAGAACCGAGAGAA
GAACTTGACGCTCTTGAGATACTCCACGGCAAACTTGAGGTCTTTCTCCGACCGCTGATTCGATTGCCGCATGAAAATGTTCCGAATGATGTCTTTGTTG
GAACGAAAGCGCTTTGTGATCTCCAAGGTATTGGCACCAGCATCAGCTTCCTGTGACTCCTTTAGCAGCTCCTTGAAAACAGCTCGAGTGATGAAGACGA
GCTCCACGGAATCACTTGCCACAACGGCCGAAGCTGCTCAAATAGATTTGGTACCATGAGTTGACCGCTGCAAGCATTCACATTCGGCGGCAAGTCAGAG
AAACGAAAGGCACACCTGCACGCTGGTCCAAATCGGTTAGTAGCGCTCGTTCTCCGAAAGTGTCTCCAGGATTGAGCTTGGCCAAGTGCAAAAACGGATC
AGCCTGTGCGGGATCGGCAGCCAGAACCTCGTCAAAGCGAACGATCTCGACTGAAGGCGCATCAAAACAAAGCATCGACAGATTAGCAAGAAGCCCAGGA
AGGTGCGCTATGATCGGCATGCAGATGAAAACCTTGTCCAGTGTAGACCAAGTAGAATTTGTCGCCTGGGTCCCCCTGCGATGTGCAACCAACCGCAGCA
ATGAACTTCATGTACTACTGATATGCTATGAATCGTCACGCTGCTCTGCACGTACCTCCTCAAAGATGTAGGCTCCTTTCTCCGAGAGTTTAGTCATTGA
TAGCGCCTGATAGAGTCGATCAATCTGTGTGTTGGCACGATGCGAGCGGGAGGAGAGTTAGCTGAGCTTGCAAACCTGTTGTTCACAGGTACGCCCACTC
ACCTTGTCTACGAACGTATCTCGCAATGTTAATGTTAGAACTCGATGAACACACACACGAGAAAACACACAATAGAAGCTGGATAACCGTACGTACAGGC
ATCGAGATTGGCAAAGAAGTCGAGCAACTTGGAGGACGCCAACAGCGATTTCAGCTGCAATAAACACACCGTGAGAGCCCATGCTGCAGTACCATATGCA
CTATCCTCCACGTTGCTTTTTTGGTTTTAGGTTCACGCACCATGTGGATGTCGTCGAGGGTGCGCTTACCCTGCGGTTTGGTGAGAATCGCTCGACACGC
CGCAACCTCGGCGCGGCCGCTCTTGACGGCCTGGGCGAAGGCGCCCTGCTGCGCGAGGGCCTCGAGCTGCGACGCCAGCGACACGCGGCGAATGTCTTCG
TCCGCCTCCACGCCCTGTTCGGCCACGTCGTCGACGATCTTCCTCCCGTTAGCGCCATGCGCGTTCACCTTGCGTCTCGGCATATTGAAATGAGCATGCC
ACGATGTTGCCACGTTGCCCAAAATAGCGCCCGACTTCAAAAAAAAAGAAATACTCGGACAACCGCAATCGTATTCGTGTGCTCAAGCGACGCAGGCGAT
TCGAATAGATGTGAGCTTGTCCGCTTTCAAATTCCACCGCGTTTGCTGGGAGCGCTTGGTCGTCGCTTTTGACATGCCTGCTCCACACTTCGGCGGTCGT
GCATCATACGCGATAGAAAACTACGCGACTGCGACGTCTCCCCAGCGAACAGCACGGAGAGCACTTCCAAGACGCGCAGCATCCACCATGTGCTCGTAGC
TCATGATAGCAGCTTGCATCTGGGACTCGCCATTGCACTTCAACTTCTGTAATGGTGCGGTAGCGCGACATTCGAGCAACATTCAATACTCCTTAAGGAG
GCAGTGGTGCGGAAAAGCAACATCACGGCAACATCTTTATCCGTAAACGTGAAATGCAACAGCAACAACAATAAGAAAGAAGCGAAGGGAGCATGGACGC
ATGGCGGCAGGTGGTGGAGGACGCAACGCGAGCCGTGAAGCGGAGCCTGGCGAGCGACAAGGCCGTCGCGCTCTACGAGACTTTGGGCTCGCACGTCGTG
GATGCGTCCACGGGCGGCGTGCTCTTCTGGATGGGCGTCTCCGGCGCGCAGCTGCTGCAGAAAGCGGCGCGCGTGGGAGCCGCGACCCGCGTGGCACCGC
GAGCAGTTGGTGTCGTCGCAGTTGCCGCGTCGTCTGCAGTGGCGCTGCACTTCGCATCACTCCCGCGCGAGATCTACGAGGCGCTGCTGCTGAGAAAGAA
CCGAGGCGAGGCCAAAGGAGCCTTTGCGTTTTTCTGGCCCGCGATCACCCCAGAGGATGAAGGGATGGTAGCGACGGTGCGGCAGAAAGTGACGACGCGA
ATAGACGAGTTCCGTGACGCGCCGTACCCCGTGTATATGCTCATGGGCCTGCTCTGCTTCAAGATGCTCGGTGGACGCATGAACGCGATTGCACCGAGCA
ATTTTTCCAACCTCGGCGCGTTTCATTTGAAGAAGGCGTCGCTTCCCGCATCAGTTGATTATGCGACCCCAATTGAACGCGGCATTATCCAGGAGTTTGG
GCGGCTGTACGGATGCCATACATGTGGTGTCAAGCAGGGCGTCAAGTACCACGCCGATCACATGCCGCCGAAACTGTACGTGCATGTCGTCCAAGTAGAA
GAGAATGCGGGTTGGTGCTGACTACCGTTGCATGTATGTCCCTCTCTTCCGTTTCTTTCTGTAGTGTGGCAAAGCGCATGAACGAGAACATTTTTCGACG
CCTCTTTCGTCAAGAAGTGACGTTTCGCTTCTATCCGCAATGCGAGCCGTGCTCCAATCAGCAGGGCAGCCTCGTGAAGCAATCGAAAGCCAAGCTGCGA
ACGCATTTACTGTCGCTGCGGCTCTATCACAGCACGGGGTTGTGGCTCGTACTGCTCTGTACAGGCGGCCTGTATGTCGGAGGCTCCAATTTTCACGGTA
CGAACAGACAGGCACGAGCTGTTTCCAGTATGTGACGAGAAAAAAATGGTGCTCATTTTAGTTTTTTGTGTATGTAGAAACGTCGGATGTGCCGTCGTCG
TCGCCGCCTACAAAGAGTGCAGATGTGCTGCAATCCATGAACCACCATGGAACGCCAGATAGTGCGCTGTTAATCTCTCTCCGTGAGCGCGAAAGCAAAC
TGAAGCGACAATTGAACAAAGCAAAAGGTGACGCGTCGCACACTGCTGCCATCAACACCGAAATCGACGCCATCGAGCGCTGTAAGGCGTCATTGAAGAC
CAATTTGAAACGAGAAGCAAACAAAACCGCGTCCAGCAAGTCCTGAAAGCATGTTGGAGAGTGGAATAAAGGGCGTCCCAATCGAGACATTTTTGTTGTT
GCTGAAGATGTTTGGGGACTCTCTTGTCTTTGACTTGTGTTGCGGGCTGCATTTATTAACAACCATTTATGTAGATGCCTATCGACGAATCGGCGAGAGT
AAGGGGAACGTGAAGTCACAAAGTCGAACCTATATTTTCTTTTTACACGCCTTGGATGTTACAGAAGACACATAGACTTGCTGCGCTATTTCGGGGGTTC
AACTGCTTGCTATTTATTTGGTCCAGGCTGGTTTTTGAAGCGAAAGCCAACAAGAAGGTACGCCTATCTACCTGCTCGCTGAAAATCATGGCAACACCAG
CTCGTGAGAAACTCGCCAAGAAGCTCCTAAACAGCCACGAGTCAGCACTGGGCAACAATAGCGTGATGAGCAAGCGACGACACTCTTCGACGCATGCTGC
TCATCCTCAGCGTGGACACCGTCTTCAGCAGTTGCCATCTCCGACGGAACAGCAATTGCAGCAACGAGAAAGCGGATGGAATGACCGCTTTTTCTATGAC
CCGCCGATCAACTCAAATAAGCTTCCTCGCCCCAGTAACAACACCCCAATCTCGCCACAGAAACAATCGGCAGCAGCCCGACAACAAAAGAGCGAAAAGA
AAGTCCGTGAAGAGCGTCTTCAATATGGTAAGGGATTGGAACAAATGCTTGCAAGTATTGCATGCCCTTACCATGTGAGCATCTCCTCTAGGAAACAACG
ACATGAGACGCAAGCTCAAGGAATCTACGCAACTAGCAAATGGGCGGCTTATGCCACTGAGTTTCTTAGCTGATCCAACAACGGTACGCTCACAACTTTG
ATGAGGCATAGATGCTTTTACATCCACTGCACGTGTTTGACTTTTTCAACTATGTGTGTGCTGCTGAGAAGCTTCACCCGTCCAAGGAGGAGAAACTTCG
AATTAAAGCGCTGAAAGCGATTGATGCGCGTGAGAATCTACTGTATCAACTGAATGCCCTGATACTTTGCACACCCGCGCAGGAAATTCTTTTCCAGCCA
TCCCGTCCGGTTGACCCACCTTCCTCGTCCGTTCACAGCGGCTTCCAAAGAATAAGAGCGAAGGCTGGTATGGCACTTGCACCGACGCCATCAAATCGAT
CCGGTACCTCGGGTGCAATGACAAATTCTCGAGAAGCGACAAAATTGGCCCAAAAACTTGCCGAGGATCTCCAGCTCGCGGGCATTCAGTGCGTAGAGGC
GATCGTGGAGTGGATACTTGAGGCGGGCGCTAAAGCCGAGTACGTTCGCAGAAAGAACCATGACATTTTGCGGAGACGAACGGTATTATGAGAAGAGCAT
GCGGTGTACTAACCTGTTCTCCTTGTCTTCTTCTGTAGGAAACCTCCTCCGTTTCTGTGGCGCGAACGAAATTATTTCTTGAAGATGTACAACGATTTGG
ACTTTGCGCAAGCGGAACTTGAAGCGCGAGGTGTTCACCTTGAGTGCTACACACAGCAAAACCCTTTGCTGATCCGAACCAACCAAAAGCTTGGTCGTGT
CCTGGCAGCGCAAGCAATCATCACGGAGATGGTAGAGATGGCAACTACCAGTAGCAAACGCCT