Description :
From Genome Similarity Track
Location :
Scaffold_140:4663- 6286
Transcript NameFunction/comments
Hyaar_Emoy2810875hypothetical protein

Sequence
1623 bases(100 bases per row)
GTGTACAAGACGCTGGCGGAGACGGTGACGGTGGAAAGCTGCAGCTGCGACTACGACGTGAAGTGGAACGTGGTCATGGCCACGAGCGTCTGTTGGACGT
TGCCGAGCCCGAGAGCGACGGGGAAGAAGCGCAAACAGTTGATAGGCGCTCAGACGAGGGACGAGAGGAAGAAGATGTACACGAAGTACCGGTTCGAGAG
GACGAGGAGGCAGGAGAAGAAGGAGGGAGACGACGGGATGGAGGTGTCGCTCGTCAAGTTCTCGGTGGTTGTGGCGTTTGGAGACGACGATTTGTCGCCC
AGGGAGCTGGTGTACTTTGAAATGGCGTGCGAACATCCGTATCCCAGGAGTTACTACGAGGATCAACATCGTTCAGTGCTATCGGATGAAGAAGAGAAAG
AGGAGGGAGGAGGTGACGACAGAGAGAGCGAGAAGGAGGAGAAAGAGCAGGTGGAAGAGAAGAGCAGCGACGACGAGACGTTTGGGGAGGAACAGCGCGA
CTTTCGTTTTGATAACGATGTGCTGGCTGATTTGGCCGAGTGGATGCAGTCGGGCAAGGACGAGCTGGATCCCGTTGACGTCGTTGGTTTCTTCATGGCA
TTGCCGGTGCATGAGGACGAGTGGCTGATCGACGAACGCGTGTGTGCGATTCTGTTTCAAGGTGGAACGGAAGGCGACGGCAGTGATGAAAGTGGCAGTG
AGACCGAGGAAGGGAACAGAGTTGATGCGGTGGGACGGATGGGATTGTAGACTCGGAGGAAGACCTAAGAGGGGCTGCTTGTCTCCGCTGTGACTAGTAC
TTTGCTTGACTTCAAGGCCAGATGCTCGTGTGTGCCCGGGTGTGTCTGTTTGTCGTGCCCGAGTCCTTTCATTGCTGCGTGCCTGTGTGCTTCTCTAGGC
ACCGAGACTATGAATACTGCGCTAGGAAGCTAAGCTTCACAGAAACTAAAGACAGTCACCTCATCAGCATGCATCAACATCGACTACCTGCACGAGATGA
TCCATTCGGTCATGACTGAAACCATGAGATTGCAAGATCGACAGCTAAAGCAAATCAAGGACAGCCAGAAGGACGGATAGGTCGCACGGTCCAAGTAAGT
CCTCGGCCGCAATGTATAGATTGATGTCGGGTATTGACGTATCTGGGTTCGACTCGAACCGTTGCTGGCAAAGATTCGAGAGTGGAATTGGCGAGGGCAA
ATGCAGCTACGGAGTGTTTTGGAGACCGACAATCGTTAAGCGTGCGATTGCACAATACGTGTCGTGGGTCAGTGAGTGAGTGAAGCATTTTACGCGCCGA
CTGTGTCTACTTGAATCCGTACAGCGAGTACCTCTACCTTTTTTGAATACCACAACAGCTCAGTGCTGTACGGTTACGTAGTGTTGACGTCCAGAATGTG
CTCCTAACCTAGCTATAAGTGTCTCATAACTCGAGCAGCATACTAGACTGATACCGCACAGCTCTGTCTCGCTCCGAGCGTCTCCGTTGCTCAAGAAAAA
GCACGTCGAGGGCAATCGCATTGCCGTTAATAGTGGCTTTAGCAACGATAACGATCTTGACAATGAAATAGGTCGAGCCACTGCAATACGGTGATTTTGC
ATACAAACGGTGTTGGTTAAGCT