Description :
From Genome Similarity Track
Location :
Scaffold_229:4662- 12479
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_229-snap-gene-0.12HCG1818127
Pytul_var.sporangiiferummaker-pug3_contig_229-fgenesh-gene-0.3Pc20g04080 protein
Pytul_var.sporangiiferummaker-pug3_contig_229-snap-gene-0.19Stress-induced protein sti1
Pytul_var.sporangiiferummaker-pug3_contig_229-snap-gene-0.14Conserved gene of unknown function

Sequence
7817 bases(100 bases per row)
GTAGTGACAGCGCGCCACGACAGAAGCGGCAGCGCACAGCAGCCACAGATTTAACAGCTTATGGGGTCGCGACGGTGCAGATGGTGGAGCTCATTCAAGA
CCTCCACGACACCGAATCCCATGACGACACAACACACTACGGGCTCTTCATTTGGCCCTCGGCGATGGTGCTGGCGCACTTTGTCGCTCGTCATTGCACA
CGCGTCGCGACTAACAAGGTGGTGATGGAAATCGGCTGTGGCACGGGACTGCCCGGGATCCTTGCAGCCATTTGCGGCAAGCCTAAGGCGGTAAGTACAA
ACTCCTGCTGTACGCGTTCATGGACTTGTTGAGAGTAACTGTGAGGGTTGACTTCCGTGGATGACCTTTGCTTGTGTAGGTGTATCTGACTGATCGCTCG
GACGCGATCGACATCCAACGCAACGTGGAAGTCAACATTCGGATCAACGGCATTCAGGACGTTGCCAGCTTCCTCCCACTGGACTGGGGCCAAGTAACGG
GGAATGAACACTTGCTCGACTTGTTTCAGACGGTGGATGTGCTCCTAGCAGCAGATTGCTTCTATCGGTCGGAAGGTAACGATCCAGACTATAAAGAGGT
ACAAATGTTCACATCTCATAGCAGCTGTGCACGTTATCTTTACGCAAAGATTTCGAGAACGTGATTGCGACCGTCGCATTCATCTTTCGCTGCAGCCCAA
AGTGCAAACTCTACACCACATATCAGCTTCGAAGGTATGTGCCCATGTCTGCATGCCTCAATCAGATCATCAACACCTGCAATGCTTAACATGCGCCACT
TGTCTACATATGTGCGTCAGCATCACTCGGTCCATTGCACCGCTGCTTGCTCGCTGGGGCATGGAGGCCAGAGCCGTCGATACTACGCCGTTCCTTCCAA
TTGCTGACACAAAAGCTGGCAGCACCGACAACGATCCATCCTACGAAGGCATCTATCTGTACGAGATCTCGTCTTCAAGATACTACCCAGACAAGTGAAT
AAGCCCACTGTGTGGAATATAGACGCAATGCGATAGACGGATGGCTCAGATTCGCCTTTTCTTTCTCTTCTCTCATATAGGAGGCAACCCATATACACAT
ACACAATGATGTCTCTTTCCAGCCTGCCGTCAAGTTGTCCACAGTAGCTTCTCATGGACAGACTGGCAGCGGAAAGCCACTTTTTTTATATAATCCTTCT
TTTGTATCAATGCACATATATCAATGCGTCGATCAAAGGGGAAGAGAAGCACCACGTGAAAAAGCAAAAGACGACGATGGTCTTCAGCGTCTCTCCTTTG
TGGGCTCATGAGTTCCCCATACAGCAGCAAAGGATACAGAAAATATTCCCAATCGAGAAGCCAGCAAAGTTGTCTTCCTCGCCATCCATACCGTCCAGTT
GCACCGCAGCGCACTTTATACACGCACACAGCAGCGTATGTATAGACACATAAGTAGATAGATATACGCAGAGCGACTGCCGCCCATCGCCAGCGTCATC
GCGTCCATTTTGCTGCTCCATACTTCTCCGCATTGGCTTTTTCTGTGCATGACCTCTTCAATAAAAACCTCAAAAACGAGGTTTTTCCACCAAAGATTCG
AGAAACTCGGATTCGGCGCACATTTTCAGCCAATAATATCGCGTGTAGTCATACTTTTTTATCCAATGCGGGGGGCGAGTTTATGTGGCCCATGTGATCT
TGCGGCAAATTGAACCTTGCGGCATTCCGCATTCTGCCGAACAGCTCCGTCCGCATCGTACAGCCCATCATCCAGCATGCTTGCCCGTGTCGCCCGCGCC
GCGTCGGTCTCCATGACTAAGCGCGCCTCCGTCACCGCGCCAGCGCTCGGCGCCTTCCAGCTGCGCGAAAAGTCTTCGCTCACGTCGCTTCTCAAGGTGC
GATAGCGCTTCTGAATGATGCGATCGTCACTGCCGTGACTTCTATATGTGCGCTCATGTGAAGCTGTGTGTTCGCTTACGACGTCGATGATTTACTTGTG
ATGAATAGCGTGAGATTGAAGAGGAGAAGGGCAACTGCTTTGAAGGTGAGGAGCTCGAAGAGCTTCACGCCAAGATGAACAGGATCTTCACCTTGAAGGA
GACCCCCGGCAACATGGAGATCGTGCTGACCGGCCAGGTCGGCACCGACTCGATCCGCATCAAATTCGACTCGCAGGACGTGGTTGAGTTGGAGGAAGAC
TACGTCGATGAAGACGAAGAGGAGGAAGAGGAGGAAGCCAACTACGATGAGGAAGAAGAGGAAGAGGACGGCGAAGAAGACGAGTTGCCTGGCATTCGCT
TCGTCGCGGACGTCACTCGTGACAACCAGGGCCTCCAATTCGAATGCGTTGCCAGCAGCAACCTGACTGTCGAGCGTGTGCGTTTCCTGAGTGATTTCTC
GGCCAACGCCGAAAAGGACAACCTGTACTTTGGTCCAAACTTTGCCGACATGGAGTTGGACGTGCAGGAAAAGTTCTACGATTACTTGGCCGAGCGCAAG
ATCGACGATGACTTGGCGCAATTCATTACCCAGTACGCAGACCTGAAAGAGCAGCGCGAGTACCTGTCCTTCTTGGAGAGCGCCGAGACGTTTATCAAGA
ACTAAGCAATAGAAACAACAGACACGCACAGCCTCGGGGTTACTTGTACCGCATGTAGTAAGCACACAAACACACAAAAACAACGGTTTAACGCTAGCCT
AACACACACAAAAACCTGGAGTTGTACTTGGCATGTCGCTTACAAAGCTAGCAATATCTCTTTTTTCTACCGCCACATCGTCACGCTGCTTCCGCCGTGG
CATCGCGAGTACTTTATTGCATTCTAGACATGACGTTCTGGAGAAGCTGCGAGACCTTGGGGTTGGACATGTGGCGCATGGCAGCCGACGGACCTTCCGA
GTCCACGTCGCGGAAAAAGTCCTGCAGGTCCGGGTCCGATCGCGCCGCNNNNNNNNNNNNNNNNNNNNNNNNNCTCGGGGCTGTTCATGAGGCGGCTCAT
ATCAGGCATACCACCAGTGCCGCCGCCTGCACCTGGAGAGGCGCCACCACCCATGCCGCCGAGGTTGTTCATCATACTGCTGAGCATTTCTGGGTTTTGC
ATCATGTTTTGCGCCCTGTTCGCGCCCAGACACAACACACATAAGCACGCAGTGAGTTCACATCCTTCTCAGCCTCGAGGGCAACTTTGCACGTACATTT
GCATCATTTGAGGATTCTGCATCATGCTCGACGCCATTTGCTGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCGGTTGTCTGCACTTGGCGACGCTTGCGT
TCAGCTTCCGCGAGTCCGTCCTTGCAAGCCGCGTTTGTGCTGTCGACCTCCAAGCCGCGGCGAAATGCGTCAATCGCACCGTCAAAGTCCTTGAGCTGCA
CGTACGCGTGGCCCATACGAGAGTATGCCTTCACATACGCAGGCTTCAGCGCAATCGACTTCTCCGAGTGGTCGATCACTTCGTCGTACTTGCCCAAGTA
CGTCAGCGCCGCCGCGAGGTTCGAGTGGTAGATGTGCGAGTTTGGACCAGCTGGCGACAGCTTGAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCAT
AGTGCGCAGCCGCTTGCTTGTAGTCTCCTGCGCTCAACGCCGAGTTCCCTTTGCCCTTGGCCTCTTCAGCCTTGGCTTCCTTTTCTTCCTTCGACATAGG
TGGCTGCACACAAACATACGCAGTTCACACGATCAATAACACGCTCATCACCAAGAAAAAGAGTCCAAACAGACTCGATGAAAGAACTTACCGCAGCAGG
CGCTGGCTTCTTGACGTCGCCAAATTTCTCCTTGAACTTGGCCAAGGCCTTCTTCAAACGGGCCGTGTGCTCATCCGAACCCGCCGGCAAACCGTTGAAA
AAATTCTTCTCTTCCAGCTTGGCGATCCACTTCTTCCACAGGTCAGGGTCTACAACGCACACACACAACGCAAGACGGCGTAAGTGCGCAAACATACAGA
CTTGCGCTTCTACTCATAAAAGCGATACATCATCGTACTTTTCAAGACAACAGGGTCTTGGTCCACCGAGTCCAAAGGAGACGCCTACAAGCACGATGAG
CAGTAACAGTCAGCGCTTCCACAATGGCAAGAGAGACCCCATACTTCGCCCAGCACTCCATATGCAGTGCACATACTGCGCCGATTTCAATGTTAAGCGC
CTTCAGCCCAGCCGCAAAGATGTCTTCGAACGTAGCCGAGCCGCTCAACGCATACGTGCGCTTCTGCTGCTCATCGTGCACGTTCAATTTAAACGCCTCG
CTACACACAGCCACAAGCAGCATACACACAGTCCCATTCATTATGCAAAAGGCCAGGTACACAGAAAGCACGTCAGTCATTTGTCCTTCTCCTCGCTCCC
ACGTGAGCTTCCACTGCGTCCAGCGTGTCGTCAATTGTTTTGCCTAATACGGCACACGTTCATGAAAAAAGCACGCACCTGAGGCACTGGACGCCGACCT
CTACGTTATCGGTGTCGACTGCATCGTCCTTCTTCTTGTTGTCGATCCACGCGAGCGCGTGGAAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGGCCGCATCCATGGCCATTTCGTTCGTTCTCTCAGTCGAATATTCCAAAAGTGTCGCGTTCCTCCCTTCCGTTCCCCCAAGCAATCTTTTCAGCCAA
TCAAATATTATTCTACATAATACCTCATCAATAATGCGATGTGATTCGTTGAAAAGTACGACAGAATAAAAGATTGCGAAGAGCCACGATACCAAAATGC
GCCAACATGGAGCCCCACTGGACGGGCAGCGAGGACGACGAGGACGAGGCCGCGAGTACGAAGGTCGCGAACCTCGCGGCGCTCGAGCAGCGCAGGCACG
AGGTCAAGAGCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGGCGTACT
TTCTCGAGCCGCTGCCGCCGGATTACCCGAGCGCATCCATCCACGATCGTCTTTTCCAGTGCCACAAGGTCCAAGCCTCACAGGTATGGCTGCGTCATGA
GAAGCAGCTGCGCTTTGAGTTCGATCCGCCAGACGAGTACCAGCTCGAGTGGCGAATCTCAGCACTCGGCAGAGAGAAATGTGCGAGCGTGTTCGAGCGC
TTTGACGTGGACGAGGATGGCGCGTGGAACTACAGCGAGTTCCTCGAGTACCTCGCCGCGCTCGAGCGGGAGCGAGACCGGCCAGATATCCGCGCGTTTG
CAGATGACCCGGAGGTCTGGCTCATGTACATGAGCGACCTCTTCGACATGGATGCGCATCTGCGGCTCACGTTCCCGGGTTTCATCTTGTACCGCGAAGC
CATTGAGCAAGACTCGCCGCTGGAAAACGACCTTCGCGTGCTCAAAATACCGATGGAATGGGAAGGACTAAAGATGATGCGACGTTGTAGCCGCATCTTT
GACGAGTACGCGGATACCGAGGGTGGTGTGGGCCTGAAGACTGCGCAGTACCTCTTTGCCGAGGCTGGCCGCGCTCTCTCGTTCCACGAGCTCTGCGACA
CAATTCATCGCCAACGGTTGATGGCACGATGCTTCAAGTCTATTCTGCAACCGAAGCGCTCGCTTCGTCTCTTCGGATATCACCAGAAGATGCGTTTGTT
GTACACAAACCCAGTGTTGGACGAAGAGCCAAAGATTTGCAAGCCTGGGTTCCTGAGTCTCGTGCTGTCGTCGTGGACGCCTGCATCGAAGACAGTAAGC
TGCCTCCCTTCGTATATGGGATGCTGTGCTTCAGGGTATCTGATGTTATGTTTCCTTCCTGGTACAGCGCTGGCGGCAGTGGTTGATGCGCTCTCGACTG
GTCGCATTCACGAAGTTGCGACAGTGGCAGCGAGCTACGTCCTGGGCGTTTGACAGCATTCGGCTCATCACTCGCACTGGCCTCCTGCGCGCGAGCTGCC
TGTTCTCACACAGTCCGCAGCAAGAAAGAGGTGACTACGTGTTCAAGATGGACGTTGGCTCTCGGTTCTCAACCCATGCGACTATGCACGTGTCCTACAA
CAGCGACGCCGACTGTAAGTAGCTCCTTGATGATTTGATATGCTTGCAATTCTAACACCCATAGCTTCTCTCACACACGCACACACGCTGCCAATAGCTG
CTGCAGCGCTCCATGAGCTGAAATACCTCGAACGAGGAGCTGAGTGCTTTGCATACATCGATCTGGCGTGCCGAAGCGGCGCCAAAGGTAATGAATGTGT
TCTCCATTGTTTGTCTACTTGGATGCATCTTTTTGTGTGCTCACATCCGCTAACAATGCGGTTCGTTCGTTTAGACAATGATGTGCAGTGGATTACACAA
AAGTTGACGTGGTTTCTCCATGAATACTTTCGAGATCACTTGGAGAGTCTCCCGTTTTTCTACAAATGGTTTGTCACGGTCCCGTCCAAGCTCCAGCTTC
GCTCTGGTCCGACCAGCAGCATTGGCACTGCGTCTTCGTCGTCGGCGAGTGCGACGCTAGTCATCCGCATCGTCGTGCTGTTCTCGGGGAAAATGGATCT
CTACCAGGTGATGCAGAGTCTGCACTTGCCGTCGTCGGTGCAGTTCGACCACTTGCTACAGCGCTTTTCGTTTCGGTGGCTCTGCAGCAATTCGCTGGAA
GAGATCTTGACGAGCAAGCGGCTCGTGCTCGGCTCGCAATGGGCGTGTCGCGCACAACTGGACACGCGGTTGAACAAGCAGGCATTTGCGCAGATCTTGT
CTCAATTGGCGACGAAACTCGAAACGGATGCGACTCAAGAAGCCGATGAGTTTGCGTGTTTTGCACGAGAGAAAGCAGCGTTCAATGGCGTGCACCATGA
GCAGCAGCAGCAAGGCAGTAGTTCGCCCAAGAAAGCTTCAGCGGTGTCTTCAAGCAACCAGAACGAGGCGACTGGCAATGATGGGGACGACAAGTATCAC
CGTGTACACCTGTGGCTGCGCGATGCTGCCAATATGCTCAGCGCGTCACACGAAGTGAGCGCGACGTTTTCGTTTGCGAACCTGAACGACATGCTGCTAG
GGAACCGCTGGATCGCGAGTGTGCTCCCGTCAAAGCTGTACAGGCGCGTGAAACATGTGCTCACGACGCCAGGCGGCGTTGCAGCCGAATGGAAAAGCGG
ATGCGATTCATTCCGATCCGAGTTTGCATCTGCGCGTCACTTCCAGGGAAGCAGTGACGCTGGTGGAGGGAGTCGGACCTGGTCCCGAGCGTCATCACGG
TCGTCCGCCCAGCTCACAGACGATTTCAACGCCATTAGTGGTTTGGAGCACTCTATTGCCAGCGCATTTCCGTTCGCAACGCCGGCGTCGACGTCGGAAG
CTTTGAAGCGCTCCGTTAATCCCACGAGTAACAACGGCGCACGCGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCA
GCATGGAGCAGACGAACCGGGTGAAAAGAAAGCGGAATCGTTGACGAAAGACGAGATCGCGGAGCACGAGCTGCTGGAATTGTACGACATGTGCGCGAAG
CACCTGATGGGCGTGAACGTGATCCGCGCCGAGGCCGGGACCAGTGGCATCACGTGCGTGCTCGAAGGATGGAACTTTTTCAACCTCTTACCACGCGTGC
AGAGCCATTTGGTCAAG