Description :
From Genome Similarity Track
Location :
Scaffold_132:46606- 51184
Transcript NameFunction/comments
Physo_143210hypothetical protein
Physo_143211reverse transcriptase

Sequence
4578 bases(100 bases per row)
TTCCTCTGACGCAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCGACACCTGAGTCTGTATAGACTGACCCTCTGTGGAGAATGG
AGCAGTTCGCTCACTTGCCACCGAACCAGCAGGATGCGCTTAAAAAGCGTATGTCCTTGCTGGGCCCGGAGGGCGTGACGCAACTTGCGCAGCAAGGCCC
CGACGCGGTGAACGCGCGTATCGAGGCGTTTTCAAGCCACGAGAATGCTCTTCTAGAGTACCTCCAGCAGAGGATGGCGACGGCCGCGGCGCCCCAAGCT
CCCGCTTCGTCATCCGACGCGGGAACAAGACCCAAGCCGTTCATGTTGAGCGTGAAGACCTTCGAAGGCAAGGAGGGTGAAAGCTTGCTGCTTTGGACCC
GTTAGGTTGATATGGCAATGAGCTCAGCTCTACTCCGGACGGAGTCGCAGCGCGTGGCACTAGCTATCTCGAAGCTCGGTGGGCGAGCGAGAGAGTGGGT
ACTAACGTCCGGGACGTTGGTCGAGGTGGCCTTTCCGACGTGGGACCAGCTGAAACAGCAATTGTCCCGAGTGTTTGCTCCGCCTAACGAGGCGTATCGC
GTGCGCTCACGCTTCCTGGCAACCAGGCAGAGCAAGAAGGAGTTGATGGAGAGTTGAGAACTTTATTGCTGGTATGTCCGCGGACCCCCTGCCGGAGGCA
GTCACCGATACGGTGTTCATGGAGTGCCTCCGCACTTGCGTTGCCAGAACGGAGGTGTTCCGAACCCACCCGAGCTCTTTTGAAGAGACTGTGAGCGTCG
CATTGAATGCGGAGCACAACTTTAAGTCGTCGAGACTTGGGTGGAATGCGTCTTACGCTAGCGCGTCGAGTGGTCCGGAACCCATGGACCTCAGCTATGC
AGAAGACGAAGAAGCCGAGCTTCGTGCTGCTGAGCAGTGTCGCGGTATCCGCAGATGCTTCATCTGTGGTGACACCCGTCACCTTCGTGCTGGGTGTCCG
CTGCGCCATCAGCGCCAAGCTTCGATAAGCCGCTCTTCGAGTTCGAACCAGGGGTCTGGTTTGTCTCGGGGAAACGAGAAGTCCCAGTAGGCGTGGGGTG
GCCTACTGGGGAAGAACTAAGTTCTATTGAGCCTCAGCGAGGTGGAGGTCGACAGGACCTAGCCCCGAAGAGAGCCGTACTCTCTAACACGGAACGTGTA
TGCAAGCCGGGCTTGCTAGTTGTCCAAGCTTGGGTGAAGGGCTTCACCAAGCCATGTACGATTTGATCGATTCGGGAGCGTCGGGTAACTACTCCCGGCG
TTCTACGATGGACGGAAGTCAGCTTTATGCTGAGGCGCTGGTAGCGCGCGGGAGTGACATCGTCACTGTTCGTCTCGCGACGGGCACTCGTGTCACGGTG
CCTAAGGTCCCTGTGGACCTGGGCGTGACGTTTTTGAATTTTGATAGCGTGGGACGCTGTCTGGTCTTAGACCTCGATTCGAGATATGATTTCATCCTTG
GTATAGCGTGGCTGGAACGCCACGAGCCTTGGATCGATTGGAGGTCGAAGACCCTTGGTGCTACGCACTTCTCTCCTAGCGGAGCATTGGCGAGTCATGA
ACCCACCTCTGCTAGGAAGCAGAAGCGCTTCTGGCGCGAGCACTGGACCGAGTCGGTCAATGTGTTGGACATCGGAGTTTCCGAGTTGGTGGACACTGAA
TGTGTCGAGAACGAGAGTTCCGAGCGTGGCTCGCGGACGGCAGGTGGAGCGGCACTAATTCCGCTGAGCGGGCGGGCGTCTGAGGGCGACGCCCTGCTGC
GTGCCAGCGACGGCGCGGTCGGCACGATGCCGAAGAACAAGGGGCTTTGCCCGGATGAAGATCGTGGAGTGGCACGTAATCCACTGAGTGGAGGCTGCGG
ATCGTACAGCTCTTTGCTGAGTGTCGGTAAAGACACTGGAGCTCCCCCGGAGCTGAACGAGGTGGTGACACCTGGCGTCAAGACGCACGCGAAATCACGG
GGCTCTTCAGGGCTGACGGTGTCCATGAAGAGGAGGCAGCACCGCAAAGCGCTGGCTGCGAGACGCAAGGCGTCTGCGATCTCACGAGTCGAGAAGGGCG
TGTCGAGCGGCGAGGCTCCACGCGAGAGCGAGCAGCTCTATACACTCGTGAATGGAGTGACGGGCGACGTCGACGGAGGTATCAACCTCGACGACTTGCC
CTCACTGTCTGCTCTCCTGGAGCTGGGCGAGATGTCCTTGGCCGAGTTCGGGGAAGCCTTGAAGGCTGGAGACTTGGCTGAGGTAGTGGTAATACGACCC
GAAGAAGAGTTGAACTCGTCCTCGCTTCTGGATGAAGCTGTCCTGGAAGACACCAAGAAGGCGCTGAATGTGCGGAGCGGATCGGCGATCCTGAAGGACC
CATCGGATGCCTTGTATCAAGTGGTAAAGGATTACCAGGACGTGGTCTCGAAGGAGCCGCCCTCGGGGCTACCTCCGGATCGAGGTGTTCGACACGAAAT
CGATTTCGTTCCGGGAACGAAGTACTGCGTGACGAAGCAGTGGCCCTTACCGAATGAGCCGTGTGGCATCATTGACGCGTTCTTCCGTACGAAGCACGAG
GCGGGCATGGTGCGTGAGAGTAAGTCTCCACACTCTACGCTGACGTTCTGTGTCAGAAAGCCGAATGGCAAGTGGCGTATCGTGCATGCTTTCAACAAGC
TGAATACCGCTATCATTCCGGCACAGACACCGATTCCTCGGAAGGATGTTCTTCAGAACAACATGACAGGATGTACGATGTACAGTGCGCTCGACTTGGT
CGATGGATATTACCAATTGCTCATGCAGACGAGCGACATTCCTCTCACTGCGGTGAGTAGCCCGAGCGGCATGCTCTGGGAGTGGTTGGTGATGCCCCAA
GGGCTTTCAAACGCGCCAGCGACGTTTAATCGTCTTGTGACGCAGCTCTTCAGGCCCCATCAGGCGTACGCGCAAACGTACTTCGATGACATCTTTGTCC
ACAGTCGTGCTGAGCACGGAAATACTGATATGGAGAAGCATGTGGAGCACCTGCGTGCTGTGCTCAAATGCGTGCGTCAAAACAAGTTGTACGCCAACAT
TGACAAATGCACCTTCGGAGCGGAAGAGATCCCCTTCTTAGGGTGCTTCATCGGGAAGCGTGGTGAGGGCCGACCCGGTCAAGGTCAAGGCCATTGTTGA
CTGGCCGGTTCCCAAGAACCAAAGGGATCTTCGCAAGTGGCTTGGCTTAGCCAATTACTTGCACAAGTACAGTGAGAACTACGCTGAGATGGCTCGGCGA
CTTTCCAACCTCCTGAAGAAGGATGCGGAGTGGTGTTGGAACACCGAGCATCAAGATGCGTTCGCGGCCATTAAGGACAGTCTCCTTCATGCGCCTATTC
TGGCTTTGCCAGACCCCCCTCGTCCGTTTTGTGTCGTCTGTGACGCCTCGGACTTTGCCATCGGCTGTGCACTGCTGCAAGCAGACGCCGAGGGGCGCGA
GCGCGTGGTGGCGTTCGAATCTCGCCAGCTGAAGGCTACGGAGAAGAACTATCCTGTCCACGACAAGGAGCTACTTGCAATGAAGTATGCGCTCGTCAAG
TTCAGGGTGCTCTCAGCCGTTCGTGATTTACACGGATCATGCGTCGTTACGCACTGCGACTCAGTCGCCTCACCTCTCGCAAAGGATGGCCCGTTGGCTG
TCCTTCTTCGCGGAGTACAACTTCGTGATGACGTACAAGCCTGGCAGGCAGAATGTCCTTGCGGACGTGCTGTCGCGCAGACCGGATTATGAGCTGGCTC
ATGTAACGACCGTGACTTCGGCATTACTGGATCTGATCCGAACGGCTTATACCAAGGACAACACTTGTGTCGCGTTGCTAAAGGTTCTGGGGAGCAAGGA
GTTTCAAGACTCGGACATGGAATTGTCAGCGCGGCTGTGCGCGCGGCTACACCGTTATTCCCTCGATGGAGGCCTGTTGTTCTACAACACTGGCCCCGAG
GATACGCCCCGCGTGGTCATCCCTCATGATGAGGATCTGAAGTACCGCATCCTCTATGAGGCACATGACGCGCCGCTGGCCGGTCATCTTGGCCGTGAGA
AGACCTACAGCTCGGTGAGCACCCGCTACTGGTGGCCGAAGCTGTACTAGTGGACGAGCACTTATGTGCGCGCGTGCGAGACGTGTCAGCGCGTGAAGTC
GTCACCTCATGCTGCAGCCCCGTTGGCGAGTTTGTCTGTCCCTTCGGGCTGTAGGCAATCCATGAGTATGGACTTTGTGTTTGGCCTGCCGGTGGACGCA
CTGGAGTCGTGGTCTTCGTGGACCGACGGAGCAAGATGGCTCACATTGCGGCTGTGCCGGATACGATCGATGGTAAGGGTACAACGACGCTGTTCTTGGA
CCGAGTGTTTCGACAACACGGACTCCCTGAGTCGATTGTCTCGGACCGAGACCCACGCTTCACGGGCAACTTCTGGAACGCGGTCTTTGCGGTGCTTGGC
ACCAAGCTGGACATGCCCACGGTGGACCATCCGCAGACCGATGGTCAGACAGAGCGCGTGAATCGCGTTGTCGAGGAC