Description :
From Genome Similarity Track
Location :
Scaffold_2634:466- 2835
Sequence
2369 bases(100 bases per row)
TGAAGATTACAATGGGCGTTTCTCGCAGCTGATCTTTCGCGTGGAGAACATGAGTAAGCTCGACCAAGTGACGAACTACGTGATCGAGTTGAAGTCGAAG
ACCCAGAGCTACGTGAAGATAGCGAACAAGGACACGCTGCGCAACACAATGGAATATGCGGTCAAGTATGAAGTTGCGTACTTTGGAGTTGACAACACCC
GCGACAAGCAGACGAAGATCGACGGTTTCAAGAACGACGTGTTCAAGAGCAACGACTTCAAGAACCAGTCGCATCCCGAGAAGAAGAAGTTCCAGTCGCT
CAGCAAATACAAGCCTCAGCCTGACTTCAAGACCAAGAACATGGAGTCGATCGTCTGTCACTTCTGCAAGAAGCCAGGCCACATGAAGAAGGACTGCTTT
TTCTTCAAGAATATCCAGGGAGATCAGGGAAATGGGGAGCCCCGCCAGACATAGAGGTGTCGGGTGCAGGCGAACCAACGCAGGGACGGATAATGTCTGC
TTGAACATTTTCTGTGAGAAACCTCTTGTGTTGAAATCTTCTCCTTTGTTTGTGTCCGAGGGTAACTGCGTCACTGATCACCATCAGTTGACTGCGAGGT
TACTTTTGAATACCGGAGCCACTACCAATTATGTGTCGAAGTTGTGCGCAATCACTGCGGTCATCTCAGGGTTGTCAAAAATGTATGAGTTTACTGTTGT
GGTGGACGACATTCGATTTCATTCTAGGGATGCCGTTCTTTGAGGGCGTGCAGCCGAGAATCGACTGGAAGAATCGTCGAATCCGAGGAGAAGACGACTC
GTCATCGCCAAATGCGGAAGAGGTGCCTGATGCGGCCAAGGGAGACAGCCGTGCGCATAAGTCCGGGCTTCAAGGTGCTGCAGTGAGTCAAGCTCAACCT
ACGATCAGCCCTGATTCCCGTCGAGTTCCCGTGTCCGAAACGGATAATCGCATCGACCTCGAAACTGCTGAAAGCGTTGAAGAGGAAGGGCCAAGAAACA
TTCTCGCCGGAAAGAAGGCAAGCCAAGTCAAACAGATGTTCACTATGGGAATCGTTGACTCAGCTGGTGTGCAAACGAAGTACATTCGTGGCAGAGCATT
TCGTAAACTCCTCCGGAAGAAGATAAAGACTGAAGATGACGACAATTTCCTGATGATTTTGTCCAACGCGACCATTCGTCAAGTGCAGCGTGATATCCGA
TCTCGCGACGAACCAGGCAACGTCAGCTCAGAGAAGGCTCGGCGTTATAAGGGAACGGATTGGGAAAGTTTTAAGAACAACCCGATCTATGAGACGCTAC
TGGAGTACGAAGACAGCGTGTTCAAGCCGAAGCTATCAGTAGGACTGCCGAAGAAGCGCGGTATCGAGCACCGAATTGACGTCCAGGACCCGAAAATCGC
GATGTTTCGTCAGCAATGGCGACTGTCACCTGATCAGAAGCAAGAAATCGAGCGCTGGGTGCACAAAATGGTGGAGAAAGGACTAATCTGTCCAAGTATC
AGTCCGCACGCGGCACCTACATTATCTGCTCGAAAGCCGGTCGGTTGGCGGATTGCTCACGACTACCGATACTTGAATTCGAACACCATTCGACAGAGTG
TTCCGATGATGTGCAAGGAAGACATGTTTGACAGCATTCTGGCGCTCACTATTTCTCGACAATGGATCTGATGTCCGCCTACTACCAAGTCCGTATGGTG
GAAGAGCACATCAAGTTAACCACATTTTAATCACCGAACGGATTATGGGAGTATATTGTGCTACCAATGGGCGTCAGTGATGCGCCAGCAACGATGCACC
GTCTCACGACCATGCTGTTCAGGGAGTTCAAGCACACAAGAGCGTTCTACAACGACATTTACATCTTCACGCAGTCGAAAGATGTTGCGGATCACGTCTC
CGCGGTACGAGAAGTCCTCGAAGTGCTGGGGAAGAACAAGCTCAATGTGAAACTGTCCAAGTGCGTCTTCTGCGCGGAAGAGATCCCATGCCTCGGTGAT
TTCGTCGGTCGCAACGGTGTTCGGATCGACCCGGACAAAGTGCAGACAATCCGCGACTGGCCAGTTCCGAATACTCAAGACGAGCTCCACAGTTTTCTTG
TTTTGATGGGCTACGTACAGCAATTCTATTACCAATATGCATCGCTAACGGCACCCCCGTTTGACTTGACGGAGAAGCGAGACAAACGCAACGCGAGTGT
CAACTTCAACAAAGAGCAACTTTCGAGTTTCAAGGCGTTGAAGAAACGACTGAGCGAAACACCAGTGCTGCACCTTCCAGACATGACGAAGCAGTTTCAT
CTTCGATCAGGCGCGAGTCAGTTTGCAGTTGAAGGTGTCCTGTTTCAAGTGGTGGACAGCATCGAATGT