Description :
From Genome Similarity Track
Location :
Scaffold_243:466- 2347
Transcript NameFunction/comments
Physo_144683reverse transcriptase

Sequence
1881 bases(100 bases per row)
GATGACTTCTTCCAAGCGATTCAGCGTCTTCAGATCTTGAATCTCCTCGGGACTGTGCGCGTTGCGACCTCCTTGACGCTGCAGAGCTTGTCCAACCAGC
ATGTCGGCACTCGCGTTCCAGTCTCGTCGTACGTGGAAGAGTTCGTGGCGCGGCCATGCCTGGAGTGCGTTTCGCGTCTTTTGTCCCAGCAGCTTCAACC
CCGGGGACTTGCAGTCCATCTCGTCCCGCATCTGCCTGATGACAAGGTTGGAGTCTCCGCATACGACGAGTCGGGTGACGTCGTCAAGCTCCTCTAGAAG
AGAACATCCGAGCAGCAGCCCGCGGTATTCCGCCTCGTTGGCCGTGAGGTCCGTCGCATATCCCGACGTGGCGCGCACGATCTCCCANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTCGCGGCCAGCGCGCCGAGGAGTTCTTCTTCTCCCTTCATGGATCGGTAGATTTCCAACT
TCCACGGCGAGAGGATCGCGGCCCACTGTGACAGCCGCCCCTGTAGTCCTTTGGACCGGACCAACCAGGCGAGCGTCGTGTGATGTGTTAAGACGCGGAC
CGGTCTCCCTGCAAGCATCGTGTAGCACTCGTTTAAGACGCGCAACAGGGCCAAGATCTCCTTTTCGACGATGTCGTAGTTCAGCTCGTTGGGCTTCAGC
GTACGGCTGGTGAACTTCACAGGCATGTACACATCGTCGTGGACTTGCGTGAGCACCCCTGAGATGGCCCAGTCGCTGGCGTACACGATCACGACGGATT
CTCGGTTCGCGTCGAAGTGCTTCAACATTGGGGTCCCGGCGAGTTTTGCCTTGAGCGCATCGAAGGCGCGCGTCGCGTGCGTCCACTTCTCATGTCCGCG
GACTTCTGGACGCGTGACGTACTCGTTGAAGTCGGTCTCCGTCAGCGAATACAGCGCGGTTGCCTACACCGCAAAGTCTGCAATGAACCGGTGGTAGTAA
TCGAGGCTACCCAAGAACGATTACAGGCCCTTGAGCGTGCGCGGGAACTCGAGCGACGTCAGCGACTCCAGATTCTTCGGCCTCGCCTCGAGACCGAGTC
CTGAGACTCGGTGGCCCCGGTAGTCGACCTTGGACATGCCCCACTCGCTCTTCTCGACACTGATGGACAAGTGCCACTGTTCGCAGACATCCAGCAAGCG
TTCGACCTTCTCGCACAGGTCGTCCCACGACGTGCCCCCGATGAGGATGTCGTCGATGTACGACCTCCGTCCCAGAACGGAGTGAATACCTGGCTTCACC
GGTTTGCCGTCTTCAAAGACGTCCCGAGTGCTGCCATCCGGGGACAGCTTCATGAACCCGTAGAGCACGTTGTCGATCAAGCGTTGGTAAATCTGCGGCG
CGTTGCACAGGCCGAACGGCATACGCAGCCATTCGTACAGTCCCATCGGCGTGATGAAGGCTGAGATGAGGCGGGCCCGGTCTGTCATGGGGACGACCCA
GAAGCCACTCACCATGTCGAGGGAGCAGTACCACAGATACTTGTCCAAGTCTTCGAGCAAGTCGTTGACGAGCGGCATGGGGTAAATCATCAACTGTGTC
AGCCCGTTGATGAGCCTGTAGTCAATGCAAAGCCGGATATCGACGGCGTTCTTCTTTATGATCACGACAATGGGCGANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTCC