Description :
From Genome Similarity Track
Location :
Scaffold_281:466- 1625
Transcript NameFunction/comments
Phyin_T30-4PITG_21327Putative uncharacterized protein

Sequence
1159 bases(100 bases per row)
GGACGCCCTCAAAGCTCCCTCAGTGAGCACTTTACGCGTACGAACGAAATGGCAAATTCTTCGCTGTACTGGACTGTATGCAATCTGTGTCTTGCAGAGT
ACACTGAGCGCCTTGGACCTACACCGGAACGCATACGTGGGCGCAAGGACTATTGGCTAAAGCATCTGGGTCAGTGTCCGCTCTACGATGGTGAATTAGC
AGAGGGCAGGCGTGGAGATGATGGCGTGGACGCAATGCCAAACAAAAAGCTTAAACAACGTGAATATTTTACGGCAGCAGAACGACAGACACTATGGAGA
CTGATTTTGGAGTTTCAAGCGGAGGCTTTGCTCGCGGACTCCTTTATCGAGCTGCCTTCCGCTCGCAGGCTCTTTAAGTGGCTAAATGCAAAGTGTGAGG
GTGCGTTGCCTCGTCGACAAGTTTTGGGCTCCACAATCCTAGATAAGTATGCGGCACTCTATGACGGACAGCAATGCAATGAGCTGGCTGCCGTTCAGCA
AGTTTCGAGTGGACGTGTAAACTTTCTTTCGGATATTTGGCAAAATATTGCGAAACAACACCTTTTGGGTTGTCAACTTTCGTTATATGGAGTTGTTATG
ACTTATGCACTTTTACCTACTGGATCGGAGCACCACGCTATAGCACTGGCTCGACAAATGGAAGATGTTTTGGTGGAAATGCAAGAAAGAGGCTGGAACG
TCGGTGCAATTGTTACGGATAACGCAGGACAGTGCGGTCGAGCAAGAAGAATTTTGGCACTGCGATGGCCACAAATTTGTTTTCTGCGTTGTTTTGCACA
CGATATTAATAATATCGTCAAAACAGTTTTAAAGCGCGTATTTAAGACTGTGTCGGAGCAAGCAGCAGCGGTTGTTAATGTTTTAAATTCTTCGTCCGAG
AAGTGGCTTGTTCGAGCCAGCAAATTCATGACATTGCGCTATGGAAGAGATCCGGCCCCAGCATTGTGTCCATTGTGCATCACTCGGTGGAACTCGATGC
AAAAGTGTTTCGCGTCATTATTACGTGTGAGGATAGCGTTAGAGGATTTTGCGTACTCCTACCGAAGTGACCCTGAATTCCCGGACAAGCTTCGCGTACT
AGGCAAGCAGCAATTTTGGAGTGATTTAGAGGCAGCAGAAAAGGTGATTCGCCCCCTAT