Description :
From Genome Similarity Track
Location :
scaffold_10:46598- 49173
Transcript NameFunction/comments
Plaha_PHALS_11545trna pseudouridine(54 55) synthase

Sequence
2575 bases(100 bases per row)
GCCCACGGGCGGGATTCATGTGtttgtatccacgttcgatcCTCACTCCCGGCTCTCGCTTGGccgatcccgctactgacgTGGAAGACGCGACCTTTTA
GTCTACATAGTCggccccccggccactacacaagctgagcttgatcagcggaaagctctccaattttgatttttggTACCTAAAAAAGTTCCAATGGatt
ggtaccgcgctcgacttctaGCTCAGAGAGAAAGCGCTCCTATACCCGCAATGTGGTCTATTCCTGGTGGTGCTCGGCCCTGGTAAAATCGCTGCAGAta
atgaagagctctttgagcgatgggttcTGCGGCACTGGACACTTTCCTTGCTGTAttccttacagcgaagccacaaggaagtgaacgtgTGCGTTGAGCG
CAATCTCCTATTTaggtttgccaaacttaaggTGCAATGCCGTCTTTCTGTGCATCGTCGCCCTGCGATACATGGAATAATCAATCACgctcccgtgagc
tctgtggtttcttacACGGGTGCGACTACAACGGCAGAAGCACAGGATCATacattgagctcagctcatggccctccggcttcctGGGCTTTGGCCGAGA
AGAGCGGTACGCAAGACGACGCCAAGCGTCATGATGCTTctaatcataagcgtctcCGACGTCTGAATAGTATtgacgaagtggcacctcaaattccctt
ggagtttgggtatccccgccacttcgcaAAATTATTGGGCTCGACCCTGTCGTCGTCGACCAACAAGGCGTTTCATGTGGTAgggacaccaccattctca
ttgaTAAGAGTCAGCGGCGGACTATGACGAcgccgtctggtgactcgcAATGGTCTTCGAGCTTAGGAGGACAGAGTCCGTCGTCGATGGCACTCCGTCG
AGCATGTTTCTAAAGTCACCTTCCTCTGTGCGGAGGACCTCCAAAGTCTGGGATCACTTTGTGCACaaactgcctcacgttgagaattatcgcgctctgt
cggagcggcttaaAAGTCATCGATCAGGTGAATgcatcacttcgtgcgacggtggagcacctgaggccgttggaaacggaaattgttgcactccgtgctc
agaatcagttgctggtctGGGTTCTGGGCGGCCAGGCGTCTTTACGTGTTGCCCCGTCGCcaatgcttccgcgttcTCTGAGCCGGAtcctggtacggct
taagcaaacccacagaaaacaccgggtgggtgtgcgTCCTTCTCAGATGGtttggcgtatacgcaagaccTCGCTCggtcacgaccttaaaatatTCAAT
CAACCGTGGATGAAACTTTGTATAAAAGACACTAAATactgtgtaggaaggtttcagCATTTGATTAAAACAGATCTTCCACCTCAGAGTCtttcacatt
tcttctgcatattctttgtgcatgtcttggctttcagccatcgcatcgcgaacatgtcgtaggacactcagtctaatAGACAGGAGGTCATCGAATTCTT
TACGGGCAgtgaggaggctgacatcagctagccgtttggctattcttccttcaccaagccccgagccatgggatgtcggtgtcagcgggacgcaaggatt
aacaagctcatacacgtagaacggtgtgtagccggtaaGTGAATGCACTACAtaattcagagcaaactctacgagtggcaatatGGCGCTCTGGAGCTTC
GGCGTCCCAGCGCAGacactgcgaagaacgtctgcgatgacgcaattcaccctttcggtttgaccgtTGGTATgcagatgatccgctgtcgacatatcca
gcttggtgtctagcaccttgaagatagtaaaattccgtgaaacggggggctctatcagagacaatcgactctgggagtccgtgttgtcggaaaNNNNNNN
NNNGCCTGAAGCTTTACAAAACAGTCTTTAGTGCAGCCCTTGACATCTATTATTTTGACAGCGCCATCGTTTGCATCGTTCACAGCATTTTGAATCTGTT
CGTACTCGGCGTGATTCAGATAGGCTCTTTTAGCATCTACAAAAAAAGAGTTTGCCTGATCACAATAAAGTTTATTGATAAAGCAGAGCGGCTACGCACC
CAGAATCTCTAGAATAAATGGTCTTCCCCTTCCAAGCATGCGCACATCCACATCTTCACGGCCGGCAGTATGAAATTTGTAGCTTACTCCCTGGAAGTAT
GCCAGAGCAATATTTCCTATACACTCTTCCACGGAGGAGCTACCCATGCGCTCTCCGTCTATTACCCAAGGTGTCTGGCTTAATCCGCGTTGAAACTTGA
CATATCGTCCTTGCATGCATACGGAACCGCGCTCGAGTTTGACCACAGCCTCCGGTTTAGTGATGAGTTGCTTAGGTGGACTTATGATGCTCTTGGGCAT
GATTGCTAGGGCGGCTAAAGCACGAGAGACTGCTCCAAAGCCATCAAACACCGTGGGTGGTCCACGACCGCGCTTTCGATTTCCTTTTAACTGAGTCTTT
GAAGGCGCAACTACATCATGAGCAAACAATGAAGACTAAGCTACATTGCTACAATACCTTGATAGCAGGAATCTG