Description :
From Genome Similarity Track
Location :
contig_140:46598- 63721
Transcript NameFunction/comments
g11661.t1hypothetical protein
g11662.t1hypothetical protein

Sequence
17123 bases(100 bases per row)
GACGCATTCTTCGCGGCGAAATATGCCGCGGGCATGGTGCGGAGTCAAAGTCGCCGCACTCGTCCCCGACGTTTTGCGTGCGTAAACCCAATGGGAAGTG
GCGCATGGTCCATGCGTTCAACAAGTTGAATGCAGCAACCATCCCGGCGTCCACGCCAATCCCTCGCAAGACGTGTTACAGAACAACATGGCGGGCTGCA
CCATCTTCAGTGCGCTCGACATGGTCGATGGCTACTATCAGCTGCTGATGCGGGAAATCAGACGTCCCGCTCACAGCGGTGAGCACACCAGCGGGAGCTG
TGGGAATGGCTCGTGATGCCCCAGAGGCTGTCGAACGCACCAGCCACGTTCAATCGACTGGTGACTCAACTCTTCCGGCCGATGCGGCAGTTCGTACAGA
CGTACTTTGATGATATCTTCGTGCACAGTCGTGCCTCAGGAGGTAAGACGGCTGTCGAAGTGCACGTTAACCACCTCCGCGAGGTATTGATGTGCATGCG
CGATAATCGCTTGTATGCGAACATCAACAAGTGTATCTTCGGAGCCGAAGAGATTCCCTTCTTGGGATGTTCCTTGGCAAGGATGGTGTCCGTGCGGACC
CTGAGAAGATATGCGCGATCGCACAATGGCCAGTGCCAGTATCTCAGAAGGACTTGCGCAAGTGGCTTGGCCTTGCCAACTACTTACACAAGTACAGCGC
CAACTACGCTGAGATGGCACGGCCACTGACGAACCTCTTGAAGAAGGAGGCGGAATGGTCGTGGACGATGAAGCCAGCAGGCTTTCGAGGCAATCAAAAG
CAGCCTGCAGAGCGCTCCGATTTTGGCTTTGCCCGACGATGATCGTCCTTCAGTGTGGTATGCGACGCATCCGACTTCGCCATAGGCTGTGCCCTGCTGC
AGGTCGATGCCGATGGCAGAGAACGGGTAGTATCTTTCCAGTCGCGCCAACTCAAGGCGGCTGAAAAGAACTACCCTGTCCATGACAAGGAGCTTCTGGC
GATGAAGTACGCGCTCGTAAAGTTTCGGGTACACCTGCTTGGCAGCAAACCCTTTGTGATCTACACAGATCATGCGTCCTTGCGGACAGCGACGTCGTCG
CCCCACCTCTCCCAGCGTATGGCGAGGTGGCTCTCCTTCTTTGCGGAGTATAACTTCACGGTGGAGTACAAACCAGGGAAGCAGAACGTCCTCGCGGACG
CGTTGTCCCGGCGTCCGGACTATGAGCTGGCGCACGTTGCGTATCTCGAGTCCCCACTCTATGAGCTGCTACGCGAGGCGTACGCAGAGGATGGCGATCT
CGCCGATCTCGTAACTTCACTGAAGGTGCCTGAAAAGGCTGTGAAACTCACTGCTCGGCAGCGCTCACGGTTGCACCGCTACTCACTAGCAGATGGTCTT
CTCTACTATCAGGTAGACGAAAGCGACGAGCCCCGTATCGTGGTTCCCAACGACGAGAACTTACGTCATCGAGTCCTCTACGAGGCACACGACACGCCGC
TCAGCGGTCATCTTGGCCGAGAGAAGACGTATACGTCTGTGGCGCGCAACTTCTGGTGGCCACATATGTATAAGTGGGTGCGCACGTACGTGCAGACGTG
TGAGACGTGCCAACGCGTGAAGCCCGCCCCATCGTCGTCGGCTCCATTGATGAGCTTGCCGGTGCCGGCTGACTGTTGGCGCTCGGTGAGCATGGATTTC
ATCTTTGAGCTTCCGGCGGACACGCGCGGCCACACTGGCATCTTGGTCTTCGTCTGTCGACTGAGCAAGATGGTGCGGCTTGTCGCGGTAAGAAGAGCGT
GACGGCGCGCAAGCGGCACAGCTCTTCGTCGACAATGTCTTTCGACACCATGGCCTCCCGGAGGCATTCGTGAGTGATCGAGATCCGCGCTTTGTGTCCA
CTTTTGGACACACTTGTTCCGACTTCTCGGTACGAGATTGGACATGTCCACAGCGGACCATCCACAGACCGATGGTCAGACGGAGCGCGTGAACCGTGTG
TTGGAAGACGTACTGCGCAGCGTCTGCACTGAAGAACCCACCAAGTGGAGCACGCTGCTACCCCAAGTGGAGTTTGCGCTGAATAATGCTGTGCATTCGT
CGACGGGTTTCACCCCATTTTACGTAAATGGCTTGCGGCATCCGCGTACGCCGCTATCGTTGCCACCGGCTTCGAATTTGGGTGGGGGAGAGGCTATCGC
CGAAGATCCGCGTGGCCTCCAAGGCCTCCGTTCGTCCGTCAAACGGAACCTCCTCACGTTCATCGAGACAAGTGAAGCAGTACGACAGCGCGTCCGGGAC
GCTATGGCGGCTGCTCAAGACACGCAAAAGGAACACAGTGACAGGCAAGGGCGTAAGAACACGCACGTGTTTAAACTTGGGGACCAGGTCCTCTAAACGC
TAAGAATCTCCCTATCCAGGCAGTCACTGCGGTGGGCAGCACCAAGCTTCGGCCACGATTCGTGGGGCCGTTCACGGTCATTGGGGTCCACGGCAACGCG
TACACGCTGGACCTGCCATCGGCCATGGCCACGCATCAACGTTCTACGTGGGCTTGCTCAAGCCTTATCGCCCTGCTGAGGCAGATGACTCTGAGAGTCC
GACGAGTTCGAGTACTGCCGAAGGACGCTCGCCATCATCTGCATCAAGTTCAGCATGGGTGGGGCTGCAGCAGCCAACGGAGCAGCGGCCCTCTGAGGAC
TGCGCCGACCTCGTGGACGCTTATGACGTTCCCACGGAGCCGGTCGGCGTTAACCCGGCCAAGAACACTTCGAGGTTCTATCGGCTGGGACTGCCAGGAC
TTCTGGACCTTCTGAAGGACCTCCTCGAGGATGACCCCGGGGTGGGCAGGCTGCGGTCGAAGCTGCGGGTGCGCCACTGGCCGTTGACGACCATCTTCGC
CATACGAAACCGAAGACGCCGCTGGGCGAGCCAATCGAGGCGATACGGAGAGTCTGGAAACTCAGGCATGGGTTACCCCAAGTGGCGGAGCCACTGCGTG
AACTCAAGTTCTTTGGATTGACGGGCCAGGTCCGTGTCGTCGTACAAGACGACCGGACACTCGTCGTAGTGCGGCAACCTGTGCCCGGGTTCCCGACTCC
GTCGGAAATACTCGCTGTAGTGTGGCGTTGGGTTTTGGAGCCGAACTGTCAAGGTCCGACGGACGTTGCACCTTTCAGTAAAAGGCGACAGGGTGTCTTG
ATTGGCTGGTCTCATTTCCCGCGCTATAGTGACCTAGGAACAATAGTGACCGAGGTCTCGGCTGGGTCTAATAACACCCCGACCAAGGTTAAAAGCCTCG
TTTGTACCCATCTGGTGTCGTACCCTCGGCTGTGTAGAGCCGGCTATACGATTTCCCACAGAGATCTGTTTACACTTGATATTTGTATAGAGATATAGGA
CTAGCCAAATGATGACCTACAGAGGCTCCCAGAGCTGTAGGATAAGAGAAATAAATCAGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCG
GTAAGTCTAGCTAGCTTGTCTTAGGGTCTGGATACGTTCGGCTGCGTGGGATGCCTGTCAGCGAGCTTGGGTACATGAACTGAGTTTGTTGCTGGTCAGT
CCAAGAGATAGGAGTGGCCGAGAGTTAGGGACGACGGAGAGTGTCGGTCCCTATATATTGGAGGAACCCGAGTGTTCCCAAGTGTATTTCACTTTACCCT
CGGCAAACCCGTATTAGGCGTGACTGCCGGTACCCTTCTTCTGAGGGACTGCGGGGGTTCGCGCGAAAGCGCAATATTATTCTAGCCCTCGCTCGTGGCT
AGTTGTGCAGGTTTTAAGGTTGACCGAACTCAACCTTGGTATACAGAGGCGCTTGCAACCAACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGA
TCCAACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGTTGTTGGTGGGACTCATACCGTTCGGTAGTGAGATTTTCTGCGTGTTCCTACACGACAACTGG
TGCCGCGACCCGGGATTGGTGTGGCCTTCTGTGTGTATAGGTTCTTACCTAACGATCATTCGAGAGAAGAAAGAAGAGAAGAAGAAAGAAGATGGCGAAA
AAGCGAAGTCAGTACCAGCAACGCCGGTGAGGTCAAGTGGAACGCGTACCGAGGGTTCGGGGCGTTCCGGTCGTCGTTCGCGACGCCGAGTACGTTGGCG
TCGATCAACGAGCGTTCGGATAATTTGATGAGCCGATGGACTACTCTGACGCCAAGGAAGATGATGAAGAAGATGACCTGGAAGAGTAAGGCAGCGATGC
CCGAGCTTTCGGAAGCCGCTGCAGTGTCTGCAGGACGCAGCGGAGGGGTGAGGTCGCTTGCGCGAAACCTCACCGAAGAGTTGAACGAAGTGGCTGGTCC
CGAACCAGCCAACGGTTACGACGAAGATGGGTCCGACGATCACGATCGTCGGCGATGGCCGAGATTCGATCTCGGCCTAATGGCGGCCGGCCTCCTCTTA
ACGGAGACACCCCGGTCGCCAACCGAGTCCGGGGCGATACCTAGAGCTCATGAAGGTGAAGAGCAACTGGATGCGATCCTTCGCTCCAGAGGGTTGTTCG
CCAAGCCATCTGGATGGAGCTCGGTGCGAATTAACTGGGCCCGTGGAGTCGTGGAGTACTCGGCAGGTGGTCGAGGTGAGGCGAGGCGGGTGAACGCCTT
TATCGTCCAGGGTGTATAGCGCACGCGCGCCAGAAGACTCGGCCGATCAGGAAGCTTAAACTTTGCCTTTCGGAAAGCCCAATGGGGTCAGACTACCTCC
AAAAGTACGGGACCCCCGGAAGTAGCTTGGCGTGTGACCTTGTAATCCCTATAGGTGTCGTTTGTCTTCGAAGACCGGACTCCACTGATGAGTTGTTCCT
ACACAATCAAAATGAATACAAGAATACAGAGTGCGTACGTTCACTTCCGACGCAATTAGTACAGCTGGGGTTAGACCACTAGCAAAGCCTTCCCAGATGA
CCAAATAATACAGAGAGTTATACACAATATACAGCTGCTACTTATTCTTTTGGACCCTTGAGCAGTGGGTCCGTACACCAGTCTACTTGTGTTTCACCTG
GAAGACTGGTCACTTCCAGATGCACCCTTGTTGCGCACCACTTCCAGTAAGGAGGATTTATAACTCCTTCCAGAAGATAACTTTCAGATATATCCAAAAG
GAAAACCACTTCCGGATCACTCAATATACAGTCCTATCACACAGCAGTCTATTCGATCAAATTCCGGGGGGACTACTAACAACCTCCTGAAACGGCAATT
ACTATGAAATGGGGGTCTAGAGGACACACTCCCAACTGAAATATGAAATAGGACAGATCACGTACGAATGCGCGTCACTCGGTCACCGCCTAATTTGGTC
TTGAGCCTTTCGGAGAGTTCCACGGCGGTCTTCGCGATCACGACGCGTCCAAACGCAGGCTGGGTGAACCCGGGTCCCCGGAAATACACGGCGGCTTGTC
CGGCGTTATCCCAGCGTGCTTCCAGGCCAACTGATAAGGGCCCTGGAAAACACTTGCGCCCTTGGTGGCAAAACGAACTCTCTGTTATTTTTAGTCTCTG
CTAGAAGTCTTCTGTCAAGGTCTCTGCTGGAAGTCTTCCACATGCACATTTGTCTTGGTTTCACTATAGGGTTCTTTGGCGTAATCAGCATCCGGGAGGC
TGACACATCCTGGTCGCAAGCCGGCTCTTCGTGCATAACATATCCGGCTGGTCGTCTTGGTCGGTCGCTAATATCTTGGGCTTTGTATACTGGAAAATTG
GAAAGGTCTTGGTGGGTACAAATCAGGGCGTCTGGTCAGCCTCCGCACCCACAACGTCTGGGTCATCTGCGAGTCACATCAGGAAGGAACTTTCGGAAGG
CACACGTGACTTCCGGAAGTAACTCGACATTGGGAGGACTTCTGGAAGTCACTTGGTCTCAGTATGCTGTGGGAACTTGTACCAGTTCTCCGTTCGTCCT
CGTTCTTCCCTGTCGCGCGCACTTCTGGACCAATCATCACCGCGAGTGCTTCCATGGGAAATGGGAAACGACGCTCGGACATTTTACGTCCAGTCGCCAC
GTGTCAACCGTCCCTCTCGTCATAAGCTTTCATAGAGGAATTTGCTTTCCCCCCGAGCTGACAGGTTGTGATGAGATCACACGTGCCCAAATTGACCAGG
GTATCCGGTCGGAAATCACATCCGGACGGCGGATTGGTCCTTCAACTGGCGGAGGTCGCTTCCTTTCTTCGCCCTGTCCCGGATCGTCCAATCACATCAC
TTCTTGGCGGTCGGAAATCAACGTCGTCGAAGCGCGATCAAATCGCAATCTCCCGCCTGGTGAGCAACAGCATGGCTCCCACTGGCACTTCAGGTCCTCC
TGCAAGCTCCGCGCAGACGCCTTCGGCGTCTCCTGGCGACGGCAGCCCCAGTGGGGGTGATGTCGCTGGCGAGTCTCCAAGCGTCCCTTCCCCAACTCCG
CCGCCCGTCGATGACGAGGAGGAAGAGGTGGAAGAGGAACTTCCGGAAGAAGAGGAAGCTCCCGATGACGCGGCGGATGAGTCGATGGATGCACCTTCGG
GACGATCGTCGGCTCAGACCCCCTCTCGGTTACTGCTTTTGGATCGAGCACTTGCTCTCCAAGGCGAGAGCGCACTTCCTTCCGGACGTGACATCCCGCA
CGACGTCAGTTGCCGCAGGCGCGTTATGAAGTCCCTCCGGAGCACACTTCCGGTAGACAGGTCCGTCTCGTTGGGTTCCGCGACTGAAAGCCACAACGAT
GGGAAAACGTTCACCCAGAACGGCTACGGCGGTCTGGAGGCGCTAATGCAGATGAATGAGTTGACCATCGGTTCTCTGGCGCAGTTGTATGATTTCTTCG
ACGAAAATGTGGACATTCACGATTACGTCTTGACGCCCCGCAAGAAACCACTTTCGGAAGATGACATGGAGCACAGTTGGTCACGTTGGTCTGAAGCGCG
AGATCGCGAGCATTCTGACCGAATTTGGTCCGGAAAATTTGGCTCAGCGGGTCTTTGGGACAGTGGACGTCCTTCAGAAGGTGATGGCTCGTTATCGTCG
GGTGCGAGAGCAGTGGACGATTCCAGTTCGGCTGTCCACGACGCCGTCGAAGCTCGTGATGAACTTCTGGTGGTAAAGCAGGACTACCAGTTCCAGACGG
ACTATTGGAGTCGGAAGGTGGCCGAGGTTCTGGCGGAAAAGGACGAGGTCGTCCGAAGTTCCCGTGAAGACATCATCCAGCTCCTGAAAGAGCATGCTGA
TGACAAGCGTCACTCAAGGAACAAGTGGCCACGCTCACCCGACGTCTGGACGACTCGGAAGCGCATCGCAAGATGCTGAGCGACCGTCTTCGACAGACGC
GTCTGGAAGTGGCCGATGTGATGAACTTCTTGAGTGACCACTCGCAGCTCTACTTGAACTGGCCTCGCCTCCGAGATCTCTTGGTTCACTTCCGGAACGG
CACGCGTGTTCCATCTGGGTGGAACACCATGATCACGGTCGTCGCAAATGACGACCCGAACTTCGCACCGACGCTTACACTCGGATGAACCGTCCTCACG
GCGACGATGACGGAGAGTTCAAGGACAGTGGTCTCCTTCAGACGCTCTGACCGTCGACCTGACGCAAGACTCATCTTCAGGTGTGCCTGGTGGCAGTTCA
CCCAAGCGCAAGCGGTCTTCTGGAGGCAAGTCACGTGGTTCGTCCCGCAAGGTTCCAGACGCCATCCAAGATTTCCCGTCCGAATGGGACCGGACCTCCG
ATGAGCAGTGTCTTCAGGACACCAGCAACATCTCGTCGGAGCAAGATGCCCACAAGATGTTGGCTGACTTCCCGGTGGTCTGGGACCAACTTCGTTTGGA
CGTCCAGATGTTAATGCGGTCTGGCGTCGGGTACTCGGGAGCGGTTGAGTTGCTCGACCAAGATCAGGTCCTCCACACCAAGTTCCCGCTCGACCCGCTT
CTGGAAATGCTGTCCGGATGATGTTCTGGAACAAGCTGGACGAGACACCGTGGACCAAGCACGTCCCGAGACGCTACTTCCGGGCGGCTCGTGCGAAGCT
GGACGACCTTCTGGAAGATGATGTTCGCCTCCAGTCTGGGACGCTCTGATGTCGCTGGACCAGAAGAGGACGACCTCATCCCGGAGGTCTTCGAGCCGGA
GGTCGATGACAAGACCAAGGATGGTGACTTCGTCCCGGGTGAGGAATTTGAGCTTCCTGAAGATGAAGTCATCCCGGTCGACGAGTCTCCTCCCAAGCGT
ACCCGTCAGAAGTCCAAGCGTCGTCGCACAAGTTCGTCGACATCTGGATCTACTCCTTCCAAGAAGCCAAGCGTTCCAAGCGTCGGAATGACCTGTCCGC
TACTGACTTGGCCCGGAAGGATTTCGAGTCTCTGACGTCCTTGGAAAGACGATCATCGAGACGCCTGGTCCGAGCATCACTTCTTGGATGCACTTGGGCA
TCCGGGTGAAAAGAGGTGATCCGACCACGCTCTCTGCCCTCCAGACGCCGGGCTTTCCAGACTACGCTCCGAACCGGTTTGACTTGGACCTCCTGAAAGA
GCGTTGCGACGGGCAAGAACTGGGTGCCTTTCTGAACACCATGCCTTGGCGCAAGATGTTCGATGAACGTCCGCGTGAATTGTACTTCCACAAGCGCGAA
GATCTGGATGACGAAGTGCTAAATGCTCTTGACGACTGGATGGACTTCGTGTGTGGAAACTTCCGGGCGATCTGGGACATCCTGCATTGGCTCACGCTGG
ATCGCTCTTCAGATGCACCGCCGGGTATTCTCAAGATTCAGACCAAGCGCGCTCGTCGTCATGAAGGTTTCCGAAAGAAGGCCTTGGCACTCCAGAAGAA
GTTGTCCACCAAGTTGCCGTCTACCATCTGGAACGAGCCTGGTGTTTGGAAGTTCCCGAACAAGATTTGCCACTGGATCCTGATGGACAAGCAGCACTTC
AAACCAGGGACTTCCGAATGTTACTCGTTGCAGGAGCAGATGGAACTTCTGGACCGCCGTGAGCCTGCTCGCGCGCAATGGAGCTTCTGTTCCACGGATG
CAGAGCGCATCGCCCACCTCCGGAAAACGTTCGTCGCGGTCTGATTCCTGCTGATGAGCGGGATCCAGTCACTGACATCTTCTCTTAGTCTTCCATTGGC
AATCCATCCGGACGTCGTCACACATCTGCACGTTTTTCTCTTCCAGTAGTCTCAAAGTTAATCGTCCGAAATATACTCACTTGACTTTCCAAATGTTCCC
AATCACAACTTCCCATAGTATCCACTTCTCGAAATTCGCCACTTACAATACACACTCGATACTCACTCCAATTTCACAGCAATATAATCACACATTTCCA
AAAGTCCGTTCGTCTGATCCATCCAAAAGGATGATATCTCGAAGGCCTAAACTCTTGGATGGTCATCACCTGCTTGCATAGTTTGGAAGCGAGCTCTCGC
ACGTGCACCTTGGTTGAATTCATAGAGTAAGGCACCACAGCTCAGTTGTGTCACTGGTAACCACTCGGGTTCATCATAGCCTTTCCACTTGATGAGGTAC
TCTCGGCGCCGCCTGGAAGTACGAGTACGTTTGGACCAACGTAAGTCCAAAATCTTTTCAACTTCGTACTCGTCCCTTCCAGCATCCGGTTCCCAACTGT
CTTCTGGAAGTAGTGCAGCATCAAAGTCGTCATCTTCGTTCACGTTCAACTCCATATTCGGGCGTTTTGGAAATAGAGCCCGGGGCTTCAAACGACTGAT
GTGCACCCAAGGGTTGACACGATATCCGGTGTCCTCGATCTTGAGCTTCACCCTGAAGTCATCATGCACTTCCTCAATTCGGAAGGGGCCATGCCACATG
TGGGCCAACTTTCTGCTCAGTCCAGGTTGGACCTTCGGATGTACAACCACACCAGGTCACCCACTTCGAACCCGGACTTCAGTCTGTCGGAAAGTTCTTT
CCACTTCTGCGTTTGCGCATCCGAACGGTGACGCTTAGCTTTCTTCTGTAGGTCTTCTGCACATGCTTTCGCATAGCTGTAGTCCCGTTGAAGCTTTCGT
CGCCACTCATAAGCGGTCCTCTCCTGAAGACTTGATGGCTTCGGACCCAACATTGCAGATAACGTCCCTTGGGCATCCCATCCGTGAACCAGATAAAATG
GCGTGTCCAGGCGAGTTGCGTCGAATGACGTATTCAGAGCGAACATGAGTCTTTCTGAATGATCGTCCCAATCGCTCTGATCCGCTTCCGAAATGTACGC
TCGGATGCTCCTGACCACCGTCTGGACGGACGCTCCTGTTGGCCATTTGCCTGGGGACGATATGCCAGTGTGGCGCGCTGTCGACTTCCTAAAAGTTCTC
GGAAGCGGTGAACACCTCGCTCATAAACCTTGGGTCTTGATCGTGACGCAACATCGAACTTGCTCCAAACCTTCGGAAGACGCACTCTTCGTAAGCTTCC
GCTACGTCCTGAGCTGTCGTCGAACTCATGGGTTTGCACATGACGAATCCGGAAAACGTATCTTGGAACAAAAGTAAAAAGGTGTTCCCACGCTCGGACT
TCGGCATGTGCGTCACAAAGTCCATCGATACAACTTCGAAAGGTCTTCTAGGTTCGATGTTTCCAGGCGACGGACCAGCATTCGGAGGTCGTCCCTTGCC
GCTGGCACAATCAACACATTCCTTCACATAGCGTTCCACATCCGCATACATCCAGGCCAATAGAATTCCGAACGCAATTTCTCGTGCGTCCGAGTGATGC
CTTGATGGCCGCCCTGATAATCTTCGTGCGCATAGTGCAGCATATCTGGACGGAGTGACTTCGGGACGACCAGCCTTGGCTCATCCACAAAGTCCCTCGG
GCGGTCTCGGGTAGATCGTGCAAGTCGGTACAGCACATCGCGAGTGTCGAGCGCAAACAAGTCAGCAACTTTGGCAATCTTTCGGAGGCGTCTGGGTGAG
AATCTGTCAACTTCACCCTTCAGGAAATCTTTGATCTCTGACAAGTACTCGTCTTCTTCCTGATGAACTTTGATGCGACGCCATCTTTCCGCTTGGAATT
CCAGAGGTCCCATTGGTGGTCCATCCAGAGATTCGGTGGTTTGAAGGCCTGACCTCGTCATGACTGCCATCACTCTGGCGGCTGCCGACAACGGGGCAGA
ATCAGCATCAGGAAGCACCGTTCCTACCTGAGCGTCCCTCGCATCAGCTTCCGGGTCCCACTGGACTGGAACTGTCATCGCCATCTGGAGTGTCAGTCTT
CGTGACCTTTTCGGGTATTTTAGACACTACTTCCAGGTGTCGGAGCTCATTTCATCTTGGACTTCCCATGACTCACCCAGTAGCAACGTCTTGGAAGTCA
AGTAATCGGCGGCTTGATTGTACTCCCTTGAGGTGTGCCAGCCTTACCGTCCGGAACTTGGCCTTCAGAACATTAGCCTCCGCGAGATGCTTTTTGCAGG
TGGGCTGATTGCAATTGATCAACCCTTGCACTTGCTGAATAACAATCCGGGAGTCACCGACCACGAATAGATCTTCGACTTGAACGTTTCGGAAGCCATC
GCCATACCTTTCAGAAGTCCATAGTATCTGAGCGTCATTCACAGTAACATCTTTCAGAATATAACCGTGTGCTTCTAGAACGGTCCAACCGGGCACCTTC
CAAAGGATGCACCCGCAACTTCCTTGACGAGTCGACGTCTTGGCAGCTCCATCGAAACTAAGGACGATCCATCGTAATCTGCATCAACATCTCAACACTC
ACCACAGGCGGCTGCCGGATCTCCCCTTTCGCTGGAATCAGTGATTCAGCAACTTTGTCTAAGTGTTCACGCGGAGTGATCCCAGCGCTCCATGATAGCA
GCCAGACCGTCCTCGTCCCGTTGAACCTTCCGGATTTCCATGTTCCACCCGGACAACGCGAGTCCCCATGGGACGCATCTTCCGTCGGCGGATTTAGAAG
TGATGACCCACTTCAGAACGGAGTACCTTGTGTAGACGATCAGTGGACAATGTTCAACGATCGTCCGGAACACCTGAAGCACCTTCATGATAGCGATCAC
TTCCTCCCGGCGACATGATACCTCACCTCGGAATCGTTCAGGACGCGGCCGGTATATCTGACTGGGTGTATCTTCCCATCATATTCCTGCCGAGGACTGC
GCATGCGCCCACTGATTGGCATGCGGAATGATGACAAACGGTCGGGAGCGATCCGGATGGCGTAGCAACGGAGTTGAGACAATCTTCCGCTTCAGGATTC
CAAAGGCCTCCTTAGCTCTTGATAGATTACGTCCTGAGCGCACTTGGTCATCCGAGAGTTCATACAGAACCGCAGCTACCACTGGAAAGTCCTCAATAAA
CTTGTGATAGTAATTGAGACTTCCGAGGAACGATTGTACTCCTTTCAGTGTGCTTGGGAACGGCAAGTCCTGAACGCCTTTCGCAATCTTAGGTGTCGCC
CGGATGCCTTCAGCACTGATCTCGTGCGACAGATACGGGATCGACTTCTTTCCGAACTCACGTTTAGGGAGGCTCACGGAAATATTCCAGTACCTCAACC
TGAAAAGGAGTGCGTTCAGATCATCACAAAGTTGGTCCCAGGTTTCAGCTCCATGTGCAATGTCGTCGATATAGGAACTACGTCCCAAGACAGGGCCCAT
CTGAGATGGTGCAGGGATATTCCTTTTGAACACAGTCATGTACTCAGTCAGCGTCGGGACTTCAGGATTAGTGTCCTCATCCAGAAGATTGGCTTCCGGA
GGGGGCAACTTCAGGAAATCCAAGACGTCTTGGTCGACTTCAGATTCTTCCTCTGGAGGCAGCCGACGAATCCCCACAGGCAGTTATTAATTACTGCCTG
ATACACCAAAGGCGCGTTTTTGAGCCAAACGGCATTCGCACCCATTGGAAGTGTCCAAACGGACACACAAAAGCCGAAATCAACTTGGCGCGCTCTGACA
TTCGAACCGCCCAGAATCCACTAGCCATATCCAAGCTCATGAACCACATTGCGTTCTCAAATCCGATCAGTAAGTCGTCAATCAGCGATAACGGGTAGTT
CGAAAGTTCGATAAAACCATTGACGATCCGGTAATCAATACACATCCGGATATCCACACCGTTTTCTTCAGGACAATCACGATCGGAGAGGACCATGGTG
ATTCGGAAGGTTCGATCAATCCGGTTTCCAAGAGTTTCTTGAGTAACTCATAGACCTTGGTAGCCAAATGGGGTGCAATGGATCGGGCGCGTTGTGCGAC
CGGCTTGGCCGTCCCAACGTCCAAATCACAAGTCACAAGTCACTCCTCTTGCTGGAGCAGGAGCAGCATTTCCGTCACCCAGAAAGATAGAGCGGTGGTA
CTTCAGGATGGACCGAAACTTTTGCTCTTCAGAGGTGATGTCGTTTCCGAATCCCCACATCAGCCGCATCAATATCACATGTCGGGCTCAACTCTTGGAG
TTCCGGAAGCATCGCCAGCTGATCACGCAATTGGGCTAACAAGTCACTTCCTTCATGAATGTACACAGCGGGTTCCAAATCTAGTTCTTCTGCGTTCAGA
CGCATTCACCTCTCATACTCAATTTCCAACTTTTGGATTGGGGTACAGAACATGGCTTGGGTTTGCTGATCCCGGAGTTCGTCTAATCCTGACAAGTCGT
CCAGACAATCGTTCACATCGTCAGCACCTTCATCCGGAAACTCTTCATTCAGACTAATCGAATCAAAGAATTCATCTCCGTCCGAATCCACGTCATCTGT
CAGAAGTTCTACGTCTTCCAAACGTTCTTCAACCCTTGGTATGACTTCCGACTCCCTTGGATGACATCCGTCGCCGGTATCTTCCGGACGTGGCATTTCC
TCAACCTCAGGGTCCTTTTTCAGCTTTACCGTGTCTTCTGCGATGACCGCATCTGGAAGAGTTTCCTCCACTTTCGGGCGTAAGATTCGAGGCAGCTCCT
GAAGTTGCACCATGTGAACTTGGTCGCTTCCAGGAAGCGGTCGAACCAATAGCTTAGCGGCCATGAGTATTCGGACTTCTGGACGCAAGGAGGTTCGGCG
TCCCTCATCATCTGCTCAAATCGTTCAGAACGTAAACGCATCTGATTGGATTCGGTATTCTCATAGATGAGAGTCTGCCACTCCTGATACCTTCGGAGAC
CCGGGCGGACAAAACGTCCTGCCCTCGGGAAGAAGCCAAACTCGATGATCCGAGCGTCCGAGTGTCAATGCTAAGACACCTTCCGGAAATGTTCACCACT
TTGATGGCCACAGCCCACGATCTAGCAGCATAGATGATCTGAGTTACCCATCGATCTCCCCGACCAGCCCATACCACATCACGTTGTGGATTGCTCTGTC
CGTAATGTATCCGGACGATTGCATGTTCACCTGGACGCAGGAAAAGCTCTTCACGCGGTCTCACCGGAAGGTCCAAACCTCTGTGGTAATGATCCGCACC
ACGTCCTGATAGCAACACAGTTTCTTCATCCGGAAGTTGCACCAATCCTTCTCGTGCGCACAGTCGCACTCCAGCGGAATACATGAAATTCATTCCAAGC
AACACGTCGACACCTTCACCAATGTTCGCGACCCAGAGCTCCAAGACATACACAATTCTTGGACCTAAAGTGATTTTCACTTCAGCACTCGCCGTGATGA
TTGTCAAAACGCCACCCAGTCCAGATACCCGGAGCTGTTTGCAGAAGCTTAGTTTGAGTTTGAGTCTACGCGCAAGATCCAAACTCACCATGCTTTCTGA
CGCTCCGGAATCCAAAAGGATGTCTGTCCGGCAATTGTTTACCGCTCCTGAACCATCGCAATCCGTTTCGTGTCATCCAAACAGTGATCTTCCCACCAGC
CATATCGTTCGCCTGGTCCCAATCGGAATTCAACAGGTACATCCGGATCTTTTACTTCCGGCCGTACACCTTCCGACAGAACTCGTTCAGAACGAAGTTC
GTCTGAAAGAGGGTCACCACTTTCCGGAGTCACGGTCATGCATTGAAGTTTATCCTGTTTTTGGCGTCTCAACTCCGGACCAACATACACTAGAAGACAC
ATATTGGGGGTTTCTTCAGACCGTCGCGTTATGGATCCCCATCCAGCGGGCTTACTAGTTTAACGGCTGTTCCCCTGGATCCACCTTCCCTTCCAGAAGT
TGCTTCCGGATAGGAGACGTGTAGCGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGGATACATTCAGGTGACCACTCACAGG
ATGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATAAGAGTCATTCAATAGATAGGGGTTCTGCAGCCATCCAAT
GGCAGAACCTCTCATTAGAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCCGTTTGGTTCATTTATC
TAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTTAAGTAGTGG
GTCTAAGCAGACCCATTACAAGACGGCAGATCTTTCAGTGCTCCTTGACGTGCAAGATTCTTGATCGTTGGAAAGCTTTCCATTCTTCACATTTGCCTTC
GTGAAACTGGTTACAAATCACACACGGACGAGTCCTGCAGAGGTGTGTCGGATGTCCCATCCGATGGCATCGATCACATTCGATGTCCGACCAACAGTTA
TCCGTTAGATGTCCAAACTCCTTGCACTTGTCACAGAACTTGGACGCGTTCGGACTTCCAAAACGTTGCTGCAGGCGATCCGAACGGAAATCAGCAGTCG
GTGGCCGCCATCCGGGATTCTCCATCGCACGAAATACTGCTTCGGAAAGGTTATCCATGCTCGAACCGGACACGTTCGTGGCATCCGCAGTTGGAGTAGT
CAGCACACTCGGAACATGTTCTCGACTTGTCACTTCTTCCACATCTTCCAAAAAATGGACTTGTCTGTCGTGCTCGCCATCCCGGTTATCGTCATCGTGA
AGAACATAGGATCTTCCAGACGTTTCGGTCTGAATCGATCACGAGGGACATTGTCCGCTCGGAAGTCTATCTTCGGAGGTGGAGTATCGTAGTCGTCGTC
TTGATTCATTTCTTCATGCTGTTTCAGGACATATTCCAGGTCCTTCAGACGATGCAGACGTTGTCCTTGCAAAGTCGTTCGGAGGCGAGAGTCCAGAAGA
TTCTTCGTGAACACTTTCAGATGGCGCTCACGTTGCTTGCTCGATGCATCGAACTCGATCCAGCATTGTCGGCCACCTTGTTCAGGCGGTAGTAAAATTC
CAGCGGGGATTCTGCTTCTTTTGGATCATCGTGTAGTAGCGTTCTGAATCCGAGGTCTTGGCCTTGCAATACATATTTCGGAACTCCTTCAGGAACTTCT
TCCATTTCCGGCGCACGTTGGGATTCAAGTTCGAACGCCAGTTCCGAACGGCAGCAGGTTACTTCAGCTTCATCTCATAGATCTTGACCTTATCCGACCA
ACCACCCTGAACGGCAAAACTCTTGAATCGTTCTAACCACCGGATACGTGTAGCTGGTGACGTCTTCTCATTGAAGTCTTCCAACGTGCTGACATTCACG
TATGGTCTGAACGTAAACAGAGATCCGCCTGGACCCGGTGTCGTATGGACATTCGGAACGACATCTTCGAAAGAGCTGCTATTTGAACTGTCAGAGTCAG
AGTCACCCCTACTGGAGTCAGAACTTGGATCAGAATCCGAAGGGTCACTTGACTTTCCTGATGACTTCTTCGTCCACTTCCTTTTCCGGAAGCCGAACTT
TCTTGGACAAACCAGACTTTTCGGAAGTGTGTCGCTTGGCTGACTTTCCGGGTGCACTTGACTTGGTTCCAGAGGAGACTCGGCCTTTCAATTGCAGGCG
TTCTACTTCCAGATATGGGTTCCGCTTTCATGTTCACACAGGCTCAGAAATCTTCACAGCTTTCCCCATCAGGTTGTTCGAAACTCTGTCAGCAGCAAAT
GCCTGCAAAGTAGCTTGCAATTG