Description :
From Genome Similarity Track
Location :
contig_138:46598- 47599
Transcript NameFunction/comments
g11633.t1hypothetical protein

Sequence
1001 bases(100 bases per row)
GAGCCCAACGTTGTGCGTGTACATCACGTGGCTCGATTTGACCCAGGAGGTTACTTTCCTGCGCAATGGGCCTTCAAGACAGCTGAATCGCAACTGATAA
ACAGCATCGTGCAGATTCGCCGCATCATAGACAAACAGCAGATGAACGCTTGCACCTTCGTTGATAAACGGCAATGGGTGCCCAACCACGAGCGCCTACA
TTGCGCCGTTTGCAGCCGGACTTTCGGTACCTTCCGCCCGCGCCATCACTGCCGAAGCTGCGGTGAGGTTATCTGCGGAAAATGCAGTGTGTTCAAGTCT
GTGGAAGTGCCGGGCACCACACTCAAGAACGTTCGCATTTGCTCTGTGTGCAACATGGGCGTACAAAAGGCTAGCGGGCATGAGGACGGGAACATGTCGG
ATATATCTACCTCCTCCGTTACTTCGAGCAGCACAGTCGCTCACAACGAGATGAACCTGATGGATCTTTACATGGGCGCCGGCGGTGGACCACGCACGCC
CTCAGCCTATTCAGACGCGTCGGCGCAGTCTAATCTCTCTATCCGGTCGACGACTTCCACACGGTCCGTCTACGATGCTCGCGGGCGAGCGCACAGTCAC
GCTCGAGGTACTCGGACTCCCCGTGCCTTTTTCAACGAAAGCACCACACCACGATCGTACATCGCCAACAATCTGACGCCTCGCAGCACACGCGGTTTCG
GCTTTGGCTCTGGGTCCACGACGCCTCGATCCGGAGCGAACAGCGCAGCTACGACCCCCTTGGGCGGCGCGAGGCCATCCATTTCTGCGGCAAGCGTGGT
GGCAGCTGCTGCTATCACTGCGCATCGCCTGTCGAGCTACAAGCAACACCCAGTTGACATCGGATACTTGCGCGATTCGGTACATGAAACCCAACCAACA
GCATTAGCACCTCGTGAACGGCCAGAAGATCCGTCGACGCCGTGGCCTCCTGTCAAGATGCAACGGCTGGAGACGGGGGAGACAGCGGACGTGGACATGG
A