Description :
From Genome Similarity Track
Location :
Scaffold_16:46593- 48507
Transcript NameFunction/comments
Sapdi_VS20SDRG_05867hypothetical protein
Sapdi_VS20SDRG_05868hypothetical protein

Sequence
1914 bases(100 bases per row)
GACACCGTTGACAGCCCGAGGATGATGTACGTTGTAAAGACGCCGAGAAACGTCAACACAAAGTGAGCAATCGTGAGCCCGTCGGGCCATCCACCTTGAA
TCGTCAAGCCAATCGTTGAGCCATTGCTGTCGGGTTGCACGGAAATGTCCATATTGGGGGCGCCTCGACGGCGGTCAAAGCCGGTGTCCAAGCAGATCGG
CGCGTCTACGTAACTTAGCAACCTTTTTCTCTATCGAAGCTACACCATACCAGAGACGATTGCGCCACCGGATGAGCGCTGGGTCGAGCTACGACGTTGT
AAGGTTGGCCGACGCTCCGAGACCAAAGATACACGTACTGCATGCACGCGGCACCCGAAAATATCTGGGTGCCTCCGACGATGAGCGCAACGAGCGCTGC
CGCCACGAATGTGACCTTGACGGGCGTGAGCCGCGAGTAGCGTTCGTAGACGCCAATGTCCCATTGGTTGCTCCAGGCGTGCGGCGTCGCCACTTCGCAC
CCGAGCCGTCCCATCATTTACAAAAGCAAGGGCGACGTTTCAGAGACGTTTCCGACGCCTTTCTGCAGTCAAAGATCTACGCGACTCACCACGTACGAGG
CAGCTGCAGGTCCGCTTGATTCACTGCCACCACCGACGTCTCCCCCGAAGACCTCATTTTAGTTGATTAAGTGCCTGTATATACAGTACTAGTACTAGTA
CGTGTTTACACTCCCGCAACCGAGCACTCGTGGGCGTATCCATCTTGGGGCGCTAAGTGGTAATAGCTTTGTCACGGAAGCGAGATACCTCTGTCATGGA
AGCGAGGCAGTTTGAGCGTACACCCAAGACGCGCAATAGGGGAAATTTGTGATGCCACTGACTGCTCTGGGTTCTCGCCAGGTGCGCACCAAAGCATCCA
GCGATGAATGCCCCGGGATTGCCGCCTACACGATGCATGTTCCAGCGACCAACGCAACTGCCATTTGAAACGGATGAGCACGCGACCAAAGCGGAGCTCG
ACGCCCGCGGCGCTGATCAAATCGCACGACATTTCGACCAAGCAGCTCATGGACGACGCGCTCGTAGACCACGATGTGAGCGAAGACGGCGCCGACTCGG
ACGACACGGACGCCAAGAAGCAGCGCAAGGACGCCCAGCGCATGTACCGCATCAACTCGTACTCGTCGCTCAACAAGCTCAACAAAAAACCCGCGACGCC
GGCGACACCGGCCGACGGCACACGCAAGCCAGCGGTGGTTGCCGCCGACGGGCCGTGTAAAAAGTGCCTTGCGAGCAAGGACATGCCGTCGATGCACTAC
GCGGCGTACGCCGGGCACCTCAGCTGCCTTCAGACGCTCCTCGCCACGGGGATCCCGCCGCCCATGGACAAGCACAAGCGGACACCACTCTTCTATGCGT
GCGCTGCCAACCAAGCAAGCTGCTGCGCCGAGCTATTGGCCCAGCGCCCCGAGTGGATCGATGTCCCAGACGCGCAGCTCGACTCGCCCGTGCACGTGTG
CTGCTTCTTTGGCTGGGACGCCTGCCTCGAGCAGCTCTTGGATGCTGGTGCCAACCCGCACGTGCGCAACGCCAAGGGCTTTCGCCCGTCGCACATCACA
AAGACGCCGGCCTGCCTCTCGATTCTCGTCGGCCATGGGGACGATTTGCTCCAAGGTGACAAGCTCGGTCGAACCCCCCTTTTTGTCGCCTGCACACGCG
ACCGCGTCGACTGTGTTGAGTTTCTTTGCTCGTGGGATTACCAAGTGCATTCGTGGATGCTCGAGCAGGAAGACGACCGCAGCGACAGACCACTGCACGC
CGCCGCCTGCAACGGCAGCCTCGGAAGTCTCCAGGTGCAGCATCGCTAACCTTGTGCGATGTGTCAACAAAAGAAATGAATGCAGGTGCTCCTGAAATAT
GGCGCCGACGTGTA