Description :
From Genome Similarity Track
Location :
scaffold_32:46588- 48800
Transcript NameFunction/comments
Plaha_PHALS_11345Uncharacterized conserved protein
Plaha_PHALS_11346Transcription factor TMF%2C TATA element modulatory factor

Sequence
2212 bases(100 bases per row)
TTGCTTTGTTCTGGAGGCGATCAGGCAATACTAGCCACATCTCATACTCAGCGGTACTTGATTTAGTCTGCCCATTGAGGAGTTCGTTTTCGTCATCATC
CGGACACATGGAAAGTTTTGCCCGCTGACTATCAATCTTCGATATCAACATTGCGCTGCAATTGCCGGCCCTGTCAAACATCAGCACGCTCGCTTTGTTG
TACTTTAAGATCGCCAGTTAAAGCCTGCGGTGTCACAACTTTAGCTTCAAAGCCATCGTATCTGGCACCTCCACGCTCAACATGCCAAATATGGTTTGCC
TAGGCTAACTAACAATGACAACTCTAAATGGCGACATCTCACTGTCCATCAGCATCTCGAAATCTCGAGATCATGCCTTTCTTCGAGATGtacaaaccac
atcgttGGTGTTACTATTTTTCACGCTTTTTCTGCTGCGTATCGTTGTGAGTGGCCAATGTGTCAAGTTGCTTCCGATAAAATGCTCTAAGCTCGCTCAC
TTCGGCCTGTAATTCTTCAACTTGTTCTTCTTTCTCTCCAAACAGCTCAAGCAGAACCACTTGATGTTTTTGTAACTTTTCGAATTCGAGCTGTACTTGC
TCACGCTGCGCCTCACCACTTTCAAGCAGAGCGTTGCGCGAGCTTAAGCGAACGATCTCATCTGTTGTTTGCTTTTGTCGAGCCTCCAGAGCTTCAATCT
GCTGCTTAAGCATTCGATTCTCACCCTCACGTAGACGCAGTCTCTGTTGTAGTTGATTCAGTCCTAAAACTGACATATTGCCATCTTTCGAATTGATCGA
GTCGCTATTTGTAGTCTCCAGCGCTGCTTTTAATATGGACGCCTCAGACATTTGCGCGCATTCATGACTTTCAccatcaatgccacattctcCAAAATAT
TGTTGTGAAGGAGAGCCAGTAGACGATCTGGCAGCCATCGCGTTCTTTAAGCGCTTCAGCTCTTGTCGGTGCCATTCTAAGTCTTGTCGAAGCTGTACCT
CATTCTCCCGAGTCTGTTCAGATTCAGCTGTGACGGCGGCTGACATCTCTAGCTTCACGGGAATCTTTGCAAGAGCGTCCAATCGTTCCTGTAGTTTTTC
TTTCGCGGCCGCTTCGGCGTCGCGCTGATGCTTCGCCTGATATAAGTCAATCTGAAGTGCGTCCACTTGTCCACGTAAGCCATATTCTTCCTCCTTCGTT
CTTTCCAGAGCTTCTTGTGCACGAACCAGCTCAGTCTGCCTTTTTGACAATTCAAGTTCGTTCTCCTCCACCTTTACTCTAAATTCGTTTACTTGCTGCT
CCATGTCAAATTTTTCTTGTTCAGTCACACGACGCTGTTCGTTCGCCTCCTCGATCCTGCCAAGAAGTGCTGCCTCAGTGGCTTTCCAGCTCTCTTGTCT
CGCACGCTGCTCTTCTTGTAAATCATGAATTTGACGAAGGAAAGGTTGTGTGGCTTCAGATACACTAAGCCCCAACAATTCTACACGAGCCACTGCTTCC
TGCCACTTGCGCTTAAAATCGGCAATCTCTGCTCGAGCCATTTCTTCACGACGAGCTGCGTCCTGCTCCAGGTCGCGAATACTCTCTTGAAGAAACAAAA
CTGTGTGTTGAAGCTCCTCTTTTTCAAGGTTAAGAGCTTCGGAAGACTTGATTGACGTCTTCAAACTGTCCAGTTCGTCGGTTTTGCTAGTCACTTCCCG
TGTCAGCTTTTCGATTCGACTTTGAAGATTTTCTACCTGACACTTCGCGTCTTTAGCTTCTTGCTCCGACCTTTGTAGCTTTATCTTCATTGTGTCTGTA
ATGCCTATaaattcttgattttcaGATGCGAGGCGTGTCTTTTCCTTCTCGCAGCACTTCAGCTTCGTCGACAAATCTTTTGTTTCTTCGATCGAAGATT
CCAATTGAGTCTGCAATTTCAGAACTCGTGCTTCCACCTCGTTTTTCTCTTTACGCAAAGTTCGTAATCTTTGCTCCAGGTGCGCCTGCTTCACAGAAAG
CACTTGACCTTCGTCTAGTAACGCACTAAGCTTCTCCTCTTTTTCAGCCAGCGCTTGTTGTAGAGCCAGAACATCAGCATTCTGACTTGTACTTGTGTCT
CGATGCAGCTGCGTCAATTTTGTTACTTCATGACGCATGTTTTCCAGCTGTTCGGTCAGAAATTGTGCACGTTCTACCGCTACAACTTCGCGATGACATG
TCTTGTCTAGCT